WARNING: This summary was generated by AI. MIR1293 is a microRNA implicated in the pathogenesis of lung adenocarcinoma (LUAD), with its high expression associated with poor survival outcomes in patients [PMC7212445]. It is one of the four genes identified as prognostic biomarkers in LUAD, suggesting its significant role in the disease's progression [PMC7212445]. Despite its emerging importance, as of the last search, there were no public reports specifically focusing on MIR1293 and its role in LUAD [PMC7212445]. MIR1293's expression level is higher in the high-risk group compared to the low-risk group, indicating its potential utility as a biomarker for risk stratification [PMC7212445]. Additionally, MIR1293 has been identified to regulate viral and human interleukin-6 through binding sites on their open reading frames (ORF), indicating a broader regulatory role beyond LUAD [PMC9495386]. Furthermore, expression patterns of MIR1293 have been observed to be deregulated similarly to other microRNAs in leukoplakia and leukoplakia-transformed cancer tissues, suggesting a potential role in other cancerous transformations as well [PMC5011738].
agguuguu cu
cUGGGUGGUCUGGAGAUUUGUGCag u
||||||||||||||||||||||||| g
gauucaccaggccucuaaacacguc u
--auuucu ca
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005883 |
| Description | Homo sapiens hsa-miR-1293 mature miRNA |
| Sequence | 10 - UGGGUGGUCUGGAGAUUUGUGC - 31 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|