miRBase entry: hsa-mir-548k

Stem-loop hsa-mir-548k


Accession
MI0006354
Symbol
HGNC: MIR548K
Description
Homo sapiens hsa-mir-548k precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548K is a microRNA implicated as a novel oncogene in esophageal squamous cell carcinomas (ESCC), encoded in the 11q13.3–13.4 region, which is frequently amplified in these tumors [PMC5294420]. This microRNA has been associated with enhanced cell proliferation in ESCC cell lines and lies within a region of chromosomal gain that includes other known oncogenes [PMC7137242]. In a South African cohort, MIR548K amplification was observed in 12 out of 51 cases, suggesting its potential role as a key gene [PMC7137242]. Furthermore, MIR548K overexpression has been linked to increased sensitivity to the chemotherapeutic agent PD-0325901 and has been proposed as a target for chemoprevention [PMC5094973]. Depletion of MIR548K results in suppressed cellular growth and mobility, indicating its functional importance in tumor biology [PMC5094973]. Additionally, amplification of MIR548K correlates with poor survival outcomes for ESCC patients and is significantly associated with lymphatic metastasis, highlighting its potential as a prognostic marker and therapeutic target [PMC6103855].

Literature search
42 open access papers mention hsa-mir-548k
(149 sentences)

Sequence

6011 reads, 129 reads per million, 74 experiments
cuuuucucaaguauugcuguuagguuggugcAAAAGUACUUGCGGAUUUUGCUuuacuuuuaauggcaaaaaccgcaauuauuuuugcuucaaccuaauaugaugcaaaauuggcu
..........((((((.(((((((((((.(((((((((.((((((.(((((((...........))))))).)))))).))))))))).)))))))))))))))))..........

Structure
cuuuucucaa      c           u         C      A       uuac 
          guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU    u
          |||||| ||||||||||| ||||||||| |||||| |||||||    u
          cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
ucgguuaaaa      -           u         u      a       uaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 70283955-70284070 [+]

Disease association
hsa-mir-548k is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548k

Accession MIMAT0005882
Description Homo sapiens hsa-miR-548k mature miRNA
Sequence 32 - AAAAGUACUUGCGGAUUUUGCU - 53
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621