Stem-loop hsa-mir-548k

Accession

MI0006354

Symbol

HGNC: MIR548K

Description

Homo sapiens hsa-mir-548k precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548K is a microRNA implicated as a novel oncogene in esophageal squamous cell carcinomas (ESCC), encoded in the 11q13.3–13.4 region, which is frequently amplified in these tumors [PMC5294420]. This microRNA has been associated with enhanced cell proliferation in ESCC cell lines and lies within a region of chromosomal gain that includes other known oncogenes [PMC7137242]. In a South African cohort, MIR548K amplification was observed in 12 out of 51 cases, suggesting its potential role as a key gene [PMC7137242]. Furthermore, MIR548K overexpression has been linked to increased sensitivity to the chemotherapeutic agent PD-0325901 and has been proposed as a target for chemoprevention [PMC5094973]. Depletion of MIR548K results in suppressed cellular growth and mobility, indicating its functional importance in tumor biology [PMC5094973]. Additionally, amplification of MIR548K correlates with poor survival outcomes for ESCC patients and is significantly associated with lymphatic metastasis, highlighting its potential as a prognostic marker and therapeutic target [PMC6103855].

Literature search

42 open access papers mention hsa-mir-548k
(149 sentences)

Sequence

6021 reads, 129 reads per million, 75 experiments

cuuuucucaaguauugcuguuagguuggugcAAAAGUACUUGCGGAUUUUGCUuuacuuuuaauggcaaaaaccgcaauuauuuuugcuucaaccuaauaugaugcaaaauuggcu
..........((((((.(((((((((((.(((((((((.((((((.(((((((...........))))))).)))))).))))))))).)))))))))))))))))..........

Structure

cuuuucucaa      c           u         C      A       uuac 
          guauug uguuagguugg gcAAAAGUA UUGCGG UUUUGCU    u
          |||||| ||||||||||| ||||||||| |||||| |||||||    u
          cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
ucgguuaaaa      -           u         u      a       uaau 

Annotation confidence Not enough data

Genome context

chr11: 70283955-70284070 [+]

Disease association

hsa-mir-548k is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548k

• Accession: MIMAT0005882
• Description: Homo sapiens hsa-miR-548k mature miRNA
• Sequence: 32 - AAAAGUACUUGCGGAUUUUGCU - 53
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621