miRBase entry: hsa-mir-1291

Stem-loop hsa-mir-1291


Accession
MI0006353
Symbol
HGNC: MIR1291
Description
Homo sapiens hsa-mir-1291 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1291 is a microRNA that has been implicated in various cellular processes and diseases. It has been identified as a regulator of the Rho GTPase activating protein 29 (ArhGAP29) through gene ontology and various database analyses [PMC5647010]. In the context of resistance to tamoxifen in breast cancer cells, MIR1291 is slightly upregulated, suggesting a potential role in the development of resistance [PMC3402532]. Moreover, MIR1291 has been associated with the regulation of glucose transporters GLUT1 and GLUT3 in different cancer cell types, indicating its involvement in metabolic regulation [PMC9663470]. In studies examining exhaled breath condensates, MIR1291 expression was found to be downregulated specifically in asthmatic patients compared to healthy individuals [PMC8196952]. Additionally, after stimulation with IFN-γ, MIR1291 was among the top 10 upregulated microRNAs, highlighting its potential role in immune response modulation [PMC8010072].

Literature search
11 open access papers mention hsa-mir-1291
(126 sentences)

Sequence

1381 reads, 9 reads per million, 74 experiments
gguagaauuccagUGGCCCUGACUGAAGACCAGCAGUuguacuguggcuguugguuucaagcagaggccuaaaggacugucuuccug
((.(((..(((...(((((((.((..((((((((((((.......))))))))))))..))))).))))....)))...))).))..

Structure
--  u   -au   -agU    -   A  GA            gu 
  gg aga   ucc    GGCC CUG CU  AGACCAGCAGUu  a
  || |||   |||    |||| ||| ||  ||||||||||||  c
  cc ucu   agg    ccgg gac ga  uuugguugucgg  u
gu  u   guc   aaau    a   -  ac            ug 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr12: 48654444-48654530 [-]

Disease association
hsa-mir-1291 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1291

Accession MIMAT0005881
Description Homo sapiens hsa-miR-1291 mature miRNA
Sequence 14 - UGGCCCUGACUGAAGACCAGCAGU - 37
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621