MIR1291 is a microRNA that has been implicated in various cellular processes and diseases. It has been identified as a regulator of the Rho GTPase activating protein 29 (ArhGAP29) through gene ontology and various database analyses [PMC5647010]. In the context of resistance to tamoxifen in breast cancer cells, MIR1291 is slightly upregulated, suggesting a potential role in the development of resistance [PMC3402532]. Moreover, MIR1291 has been associated with the regulation of glucose transporters GLUT1 and GLUT3 in different cancer cell types, indicating its involvement in metabolic regulation [PMC9663470]. In studies examining exhaled breath condensates, MIR1291 expression was found to be downregulated specifically in asthmatic patients compared to healthy individuals [PMC8196952]. Additionally, after stimulation with IFN-γ, MIR1291 was among the top 10 upregulated microRNAs, highlighting its potential role in immune response modulation [PMC8010072].
-- u -au -agU - A GA gu gg aga ucc GGCC CUG CU AGACCAGCAGUu a || ||| ||| |||| ||| || |||||||||||| c cc ucu agg ccgg gac ga uuugguugucgg u gu u guc aaau a - ac ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005881 |
Description | Homo sapiens hsa-miR-1291 mature miRNA |
Sequence | 14 - UGGCCCUGACUGAAGACCAGCAGU - 37 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|