MIR942 is a microRNA that has been implicated in various pathological conditions and has been studied in different contexts. In patients with non-ST-elevation myocardial infarction (NSTEMI), MIR942 was identified as one of the most downregulated microRNAs in blood platelets [PMC5155104]. In the realm of cancer, MIR942 has been shown to be involved in ovarian cancer progression, where its inhibition leads to the release of EPSTI1, a factor that promotes this progression [PMC7479240]. Additionally, resistance to sunitinib treatment in metastatic renal cell carcinoma (mRCC) patients has been associated with the upregulation of MIR942 [PMC6917607]. In psychiatric research, MIR942 was only identified in one study related to attention deficit hyperactivity disorder (ADHD) [PMC8077053]. Furthermore, significant differential methylation patterns involving MIR942 were observed in a study utilizing the GSE94462 dataset [PMC9922242]. In sleep-related research, while investigating obstructive sleep apnea (OSA), MIR942 was among several genes whose expression levels were significantly elevated as OSA progressed and decreased after treatment [PMC9554663]. However, unlike other genes studied alongside it, MIR942's expression did not show a significant positive correlation with apnea-hypopnea index (AHI), suggesting a different regulatory role or mechanism of action for this microRNA within this context [PMC9554663].
U uacuca auuaggagagua CUUCUCUGUUUUGGCCAUGUGug c |||||||||||| ||||||||||||||||||||||| uaauccuuucau GAAGAGACAAAGCCGGUACACac a U uccccg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004985 |
Description | Homo sapiens hsa-miR-942-5p mature miRNA |
Sequence | 13 - UCUUCUCUGUUUUGGCCAUGUG - 34 |
Evidence |
experimental
cloned [1], Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026734 |
Description | Homo sapiens hsa-miR-942-3p mature miRNA |
Sequence | 53 - CACAUGGCCGAAACAGAGAAGU - 74 |
Evidence |
experimental
Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|