MIR216B is a microRNA that has been studied in various types of cancer, including pancreatic ductal adenocarcinoma (PDAC), non-small cell lung cancer (NSCLC), colorectal cancer (CRC), hepatocellular carcinoma (HCC), cervical cancer, and colon cancer. In PDAC cells, MIR216B was incorporated into liposomes and showed improved cell penetration [PMC9683052]. In NSCLC cells, MIR216B was found to be sponged by lncPVT1, leading to inhibition of Beclin-1 expression and induction of cisplatin tolerance [PMC9373174]. MIR216B was downregulated in colorectal cancer compared to normal tissues and its low expression correlated with poor prognosis [PMC6504855]. In HCC cells, MIR216B inhibited autophagy by targeting MALAT1 and increased chemosensitivity [PMC6504855]. In NSCLC cells treated with paclitaxel, MIR216B levels were downregulated and it targeted BECN1 upregulation to increase autophagy [PMC9738256]. In cervical cancer, MIR216B targeted FOXM1 and inhibited cell proliferation [PMC7582726]. Additionally, in colon cancer, SNHG7 sponged MIR216B to increase GALNT1 expression and promote cell migration and invasion [PMC6912041]. SNHG7 also promoted liver metastasis of CRC by upregulating GALNT1 through sponging MIR216B [PMC9482270]. Furthermore, in murine tumor models of breast cancer (4T1 cells) and lung metastasis (6DT1 cells), ectopic expression of MIR216B resulted in tumor suppression but had minimal effect on primary tumor growth [PMC3912413]. The expression levels of MIR216B were quantified using the comparative cycle threshold method [PMC5732799].
--g gaA A C --A g ac cagacug AAUCUCUGC GG AA UGUGAu uc u ||||||| ||||||||| || || |||||| || gucugac UUAGAGAUG CC UU ACAcua ag g aca AUC C A CAC a ga
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004959 |
Description | Homo sapiens hsa-miR-216b-5p mature miRNA |
Sequence | 11 - AAAUCUCUGCAGGCAAAUGUGA - 32 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026721 |
Description | Homo sapiens hsa-miR-216b-3p mature miRNA |
Sequence | 49 - ACACACUUACCCGUAGAGAUUCUA - 72 |
Evidence |
experimental
Illumina [3] |
|