Stem-loop hsa-mir-216b

Accession

MI0005569

Symbol

HGNC: MIR216B

Description

Homo sapiens hsa-mir-216b precursor miRNA mir-216

Gene
family

RF00654; mir-216

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR216B, a microRNA, has been implicated in various cancer-related processes, including cell proliferation, migration, invasion, and chemosensitivity [PMC6504855]. It has been shown to be downregulated in colorectal cancer and its low expression is associated with poor patient prognosis [PMC6504855]. MIR216B is known to target oncogenic KRASG12D in pancreatic ductal adenocarcinoma cells and has been functionalized on the surface of liposomes to improve cell penetration [PMC9683052]. It also interacts with the long non-coding RNA MALAT1 in hepatocellular carcinoma (HCC) cells, where its levels inversely correlate with MALAT1 expression; both MIR216B mimics and MALAT1-siRNA can inhibit autophagy and increase apoptosis when chemoresistance is present [PMC6504855]. Additionally, MIR216B can be sponged by lncPVT1 to inhibit Beclin-1 expression and induce cisplatin tolerance by regulating apoptosis and autophagy in non-small cell lung cancer (NSCLC) cells [PMC9373174]. Furthermore, MIR216B modulates the PIK3CA/AKT/MTOR signaling pathway through its interaction with SNHG7 lncRNA which sponges MIR216B to promote colorectal cancer cell migration and invasion by increasing GALNT1 levels [PMC6912041], [PMC9482270]. In breast cancer models, overexpression of MIR216B resulted in a moderate tumor suppressive effect but significantly reduced pulmonary metastasis [PMC3912413].

Literature search

57 open access papers mention hsa-mir-216b
(186 sentences)

Sequence

478 reads, 39 reads per million, 34 experiments

gcagacuggaAAAUCUCUGCAGGCAAAUGUGAugucacugaggaaaucACACACUUACCCGUAGAGAUUCUAcagucugaca
.(((((((...(((((((((.((.((.((((((.((......)).))))))...)).)).)))))))))...)))))))...

Structure

--g       gaA         A  C  --A      g  ac 
   cagacug   AAUCUCUGC GG AA   UGUGAu uc  u
   |||||||   ||||||||| || ||   |||||| ||   
   gucugac   UUAGAGAUG CC UU   ACAcua ag  g
aca       AUC         C  A  CAC      a  ga 

Annotation confidence Not enough data

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr2: 56000714-56000795 [-]

Disease association

hsa-mir-216b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-216b-5p

• Accession: MIMAT0004959
• Description: Homo sapiens hsa-miR-216b-5p mature miRNA
• Sequence: 11 - AAAUCUCUGCAGGCAAAUGUGA - 32
• Evidence: experimental ; cloned [2], Illumina [3]

Mature hsa-miR-216b-3p

• Accession: MIMAT0026721
• Description: Homo sapiens hsa-miR-216b-3p mature miRNA
• Sequence: 49 - ACACACUUACCCGUAGAGAUUCUA - 72
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45