MIR760 is a microRNA that has been implicated in various types of cancer, such as ovarian, liver, and colorectal cancer (Liao et al. [PMC7462065]). In a study conducted by Liao et al., it was observed that alterations in MIR760 expression, both up and down, were associated with these forms of cancer (Liao et al. [PMC7462065]). Additionally, the study found that inhibiting MIR760 or mutating its binding site in the 5′ UTR of ATXN1 led to a significant increase in ATXN1 protein levels (Liao et al. [PMC7462065]). This suggests that MIR760 may play a role in regulating ATXN1 expression. The findings highlight the potential importance of MIR760 as a therapeutic target or biomarker for cancer treatment and diagnosis. Further research is needed to fully understand the mechanisms by which MIR760 influences cancer development and progression.
--g cg c u ucca c acc gcg ucgc cccc cag ccagagcc ggau u ||| |||| |||| ||| |||||||| |||| c cgu agcg GGGG GUC GGUCUCGG Cuua a caa aa A U --UG - aag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004957 |
Description | Homo sapiens hsa-miR-760 mature miRNA |
Sequence | 49 - CGGCUCUGGGUCUGUGGGGA - 68 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|