miRBase entry: hsa-mir-543

Stem-loop hsa-mir-543


Accession
MI0005565
Symbol
HGNC: MIR543
Description
Homo sapiens hsa-mir-543 precursor miRNA mir-329
Gene
family?
RF04295; mir-329

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MicroRNA 543 (MIR543) is implicated in various cellular processes, including stem cell aging, cell cycle regulation, and cellular differentiation [PMC6413650; PMC6456586;'>PMC6456586; PMC5572416].. MIR543 negatively regulates Raf kinase inhibitory protein (RKIP), which in turn is involved in Notch signaling and may influence stem cell aging through this pathway [PMC6413650]. In gastric cancer (GC) cells, MIR543 is upregulated, which promotes proliferation and correlates with the clinical phenotype of GC patients [PMC8826423]. Despite its upregulation in GC cells, MIR543 is generally expressed at low levels in cells [PMC6456586]. In the context of hepatocellular carcinoma (HCC), MIR543 expression was not elevated in tumors developed from glycogen storage disease (GSD) Ia complications, suggesting its expression may not be associated with HCC tumorigenesis due to GSD Ia [PMC6909089]. Additionally, MIR543 is part of the miR379–410 cluster and has been shown to regulate neuronal differentiation and migration by binding to the 3′UTR of N-cadherin transcripts [PMC5928554; PMC4682034].. In therapeutic contexts involving mesenchymal stem cells (MSCs), MIR543 was among the miRNAs downregulated when MSCs were used alongside cisplatin treatment compared to cisplatin treatment alone [PMC5206861].

Literature search
25 open access papers mention hsa-mir-543
(50 sentences)

Sequence

3721 reads, 17 reads per million, 68 experiments
uacuuaaugagaaguugcccguguuuuuuucgcuuuauuugugacgAAACAUUCGCGGUGCACUUCUUuuucaguauc
((((.((.(((((((.(((((((..(.((((((.........).))))).)..))))).))))))))).)).))))..

Structure
--    u  u       u  -     uu u     - uuu 
  uacu aa gagaagu gc ccgug  u uuucg c   a
  |||| || ||||||| || |||||  | ||||| |   u
  auga uu UUCUUCA CG GGCGC  A AAAgc g   u
cu    c  u       -  U     UU C     a ugu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression has been independently confirmed in mouse and rat [2].

Genome context
chr14: 101031987-101032064 [+]
Clustered miRNAs
18 other miRNAs are < 10 kb from hsa-mir-543
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-543 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-543

Accession MIMAT0004954
Description Homo sapiens hsa-miR-543 mature miRNA
Sequence 47 - AAACAUUCGCGGUGCACUUCUU - 68
Evidence experimental
RAKE [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298