Stem-loop hsa-mir-543

Accession

MI0005565

Symbol

HGNC: MIR543

Description

Homo sapiens hsa-mir-543 precursor miRNA mir-329

Gene
family

RF04295; mir-329

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MicroRNA 543 (MIR543) is implicated in various cellular processes, including stem cell aging, cell cycle regulation, and cellular differentiation [PMC6413650; PMC6456586;'>PMC6456586; PMC5572416].. MIR543 negatively regulates Raf kinase inhibitory protein (RKIP), which in turn is involved in Notch signaling and may influence stem cell aging through this pathway [PMC6413650]. In gastric cancer (GC) cells, MIR543 is upregulated, which promotes proliferation and correlates with the clinical phenotype of GC patients [PMC8826423]. Despite its upregulation in GC cells, MIR543 is generally expressed at low levels in cells [PMC6456586]. In the context of hepatocellular carcinoma (HCC), MIR543 expression was not elevated in tumors developed from glycogen storage disease (GSD) Ia complications, suggesting its expression may not be associated with HCC tumorigenesis due to GSD Ia [PMC6909089]. Additionally, MIR543 is part of the miR379–410 cluster and has been shown to regulate neuronal differentiation and migration by binding to the 3′UTR of N-cadherin transcripts [PMC5928554; PMC4682034].. In therapeutic contexts involving mesenchymal stem cells (MSCs), MIR543 was among the miRNAs downregulated when MSCs were used alongside cisplatin treatment compared to cisplatin treatment alone [PMC5206861].

Literature search

25 open access papers mention hsa-mir-543
(50 sentences)

Sequence

3721 reads, 71 reads per million, 68 experiments

uacuuaaugagaaguugcccguguuuuuuucgcuuuauuugugacgAAACAUUCGCGGUGCACUUCUUuuucaguauc
((((.((.(((((((.(((((((..(.((((((.........).))))).)..))))).))))))))).)).))))..

Structure

--    u  u       u  -     uu u     - uuu 
  uacu aa gagaagu gc ccgug  u uuucg c   a
  |||| || ||||||| || |||||  | ||||| |   u
  auga uu UUCUUCA CG GGCGC  A AAAgc g   u
cu    c  u       -  U     UU C     a ugu 

Annotation confidence Not enough data

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression has been independently confirmed in mouse and rat [2].

Genome context

chr14: 101031987-101032064 [+]

Clustered miRNAs

18 other miRNAs are < 10 kb from hsa-mir-543

Disease association

hsa-mir-543 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-543

• Accession: MIMAT0004954
• Description: Homo sapiens hsa-miR-543 mature miRNA
• Sequence: 47 - AAACAUUCGCGGUGCACUUCUU - 68
• Evidence: experimental ; RAKE [1]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298