Stem-loop hsa-mir-873

Accession

MI0005564

Symbol

HGNC: MIR873

Description

Homo sapiens hsa-mir-873 precursor miRNA mir-873

Gene
family

RF00910; mir-873

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR873 is a microRNA involved in various biological processes and has been implicated in the modulation of cancer cell sensitivity to treatments and the development of diverse tumors [PMC7589921]. It is a small noncoding RNA molecule that contributes to posttranscriptional gene regulation and RNA silencing [PMC7589921]. In the context of thyroid cancer, MIR873 is significantly deregulated, indicating its potential role in tumorigenesis [PMC4621222]. It has also been identified as upregulated during fungal infection in plants, suggesting its involvement in stress responses [PMC6965360]. In neuroblastoma (NB), MIR873 is considered a candidate microRNA that may have antagonistic effects depending on the miRISC complex status [PMC8017594]. Furthermore, MIR873 has been associated with oncogenesis and chemoresistance, as well as with adjustments in miRNA expression profiles following quercetin treatment in colon cancer cell lines [PMC5058679; PMC9380290].. Genetic studies have linked MIR873 to bone geometry and appendicular lean mass (ALM), with identified target genes suggesting its role in bone and muscle metabolism regulation [PMC3210160; PMC3706967].. Additionally, MIR873's involvement has been observed in insulin sensitivity during pregnancy, highlighting its potential impact on metabolic processes [PMC8900031; PMC7073212]..

Literature search

19 open access papers mention hsa-mir-873
(34 sentences)

Sequence

4221 reads, 152 reads per million, 76 experiments

gugugcauuuGCAGGAACUUGUGAGUCUCCUauugaaaaugaacaGGAGACUGAUGAGUUCCCGGGAacacccacaa
(((.(..(((.(.(((((((((.((((((((.((.......)).)))))))).))))))))).).)))..).)))..

Structure

--   u ca   G A         G        a  ga 
  gug g  uuu C GGAACUUGU AGUCUCCU uu  a
  ||| |  ||| | ||||||||| |||||||| ||  a
  cac c  aAG G CCUUGAGUA UCAGAGGa aa  a
aa   c ac   G C         G        c  gu 

Annotation confidence High

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr9: 28888879-28888955 [-]

Disease association

hsa-mir-873 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-873-5p

• Accession: MIMAT0004953
• Description: Homo sapiens hsa-miR-873-5p mature miRNA
• Sequence: 11 - GCAGGAACUUGUGAGUCUCCU - 31
• Evidence: experimental ; cloned [2]

Mature hsa-miR-873-3p

• Accession: MIMAT0022717
• Description: Homo sapiens hsa-miR-873-3p mature miRNA
• Sequence: 46 - GGAGACUGAUGAGUUCCCGGGA - 67
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298