WARNING: This summary was generated by AI. MIR665 is a microRNA implicated in various biological processes and diseases, including growth retardation, postnatal lethality, and cancer [PMC5886287]. It is generated from GTL2 and has been identified as one of the most influential miRNAs due to its role in the deletion of target genes that result in severe defects [PMC5886287]. Specifically, MIR665 targets genes such as Clip2, whose knockout has been associated with growth retardation and lethality [PMC5886287]. In colonic mucosal tissues, MIR665 targets Xbp1 to promote apoptosis and exacerbate colitis in mice [PMC6031203]. It has also been shown to inhibit cell growth effectively in cancer studies [PMC6145696], with its involvement confirmed in prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 is regulated by circRNA_0087207 which acts as a sponge to modulate gene expression related to DNA damage/repair and apoptosis [PMC9027941]. Bioinformatic analyses have revealed that circRNA_0087207 suppresses MIR665 affecting downstream target genes associated with DNA repair and apoptotic cell death in patient-derived cells for Leber's hereditary optic neuropathy (LHON) [PMC9027941]. Additionally, E2F3 mRNA has been identified as a downstream target of MIR665 through binding site analyses and luciferase reporter assays [PMC9701882], while miR526b along with MIR665 have been upregulated by COX-2 overexpression in breast cancer cells [PMC5762661].
-u u -c U -ACC - c c ccu GAGGGGUCUC GCCUCU CA gga u | ||| |||||||||| |||||| || ||| g gga CUCCCCGGAG CGGAGG gu cuu c cg c cA U ACCA a u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0050513 |
| Description | Homo sapiens hsa-miR-665-5p mature miRNA |
| Sequence | 8 - GAGGGGUCUCUGCCUCUACCCA - 29 |
| Evidence |
experimental
cloned [2] |
| Accession | MIMAT0004952 |
| Description | Homo sapiens hsa-miR-665-3p mature miRNA |
| Sequence | 43 - ACCAGGAGGCUGAGGCCCCUCA - 64 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|