miRBase entry: hsa-mir-665

Stem-loop hsa-mir-665


Accession
MI0005563
Symbol
HGNC: MIR665
Description
Homo sapiens hsa-mir-665 precursor miRNA mir-665
Gene
family?
RF00921; mir-665

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR665 is a microRNA implicated in various biological processes and diseases, including growth retardation, postnatal lethality, and cancer [PMC5886287]. It is generated from GTL2 and has been identified as one of the most influential miRNAs due to its role in the deletion of target genes that result in severe defects [PMC5886287]. Specifically, MIR665 targets genes such as Clip2, whose knockout has been associated with growth retardation and lethality [PMC5886287]. In colonic mucosal tissues, MIR665 targets Xbp1 to promote apoptosis and exacerbate colitis in mice [PMC6031203]. It has also been shown to inhibit cell growth effectively in cancer studies [PMC6145696], with its involvement confirmed in prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 is regulated by circRNA_0087207 which acts as a sponge to modulate gene expression related to DNA damage/repair and apoptosis [PMC9027941]. Bioinformatic analyses have revealed that circRNA_0087207 suppresses MIR665 affecting downstream target genes associated with DNA repair and apoptotic cell death in patient-derived cells for Leber's hereditary optic neuropathy (LHON) [PMC9027941]. Additionally, E2F3 mRNA has been identified as a downstream target of MIR665 through binding site analyses and luciferase reporter assays [PMC9701882], while miR526b along with MIR665 have been upregulated by COX-2 overexpression in breast cancer cells [PMC5762661].

Literature search
65 open access papers mention hsa-mir-665
(163 sentences)

Sequence

957 reads, 4.0 reads per million, 78 experiments
ucuccucGAGGGGUCUCUGCCUCUACCCAggacucuuucaugACCAGGAGGCUGAGGCCCCUCAcaggcggc
.(.(((.((((((((((.((((((...(((((....))).))....)))))).))))))))))..))).)..

Structure
-u u   -c          U      -ACC  -   c 
  c ccu  GAGGGGUCUC GCCUCU    CA gga u
  | |||  |||||||||| ||||||    || |||  
  g gga  CUCCCCGGAG CGGAGG    gu cuu c
cg c   cA          U      ACCA  a   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr14: 100875033-100875104 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from hsa-mir-665
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-665 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-665-5p

Accession MIMAT0050513
Description Homo sapiens hsa-miR-665-5p mature miRNA
Sequence 8 - GAGGGGUCUCUGCCUCUACCCA - 29
Evidence experimental
cloned [2]

Mature hsa-miR-665-3p

Accession MIMAT0004952
Description Homo sapiens hsa-miR-665-3p mature miRNA
Sequence 43 - ACCAGGAGGCUGAGGCCCCUCA - 64
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298