Stem-loop hsa-mir-665

Accession

MI0005563

Symbol

HGNC: MIR665

Description

Homo sapiens hsa-mir-665 precursor miRNA mir-665

Gene
family

RF00921; mir-665

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR665 is a microRNA implicated in various biological processes and diseases, including growth retardation, postnatal lethality, and cancer [PMC5886287]. It is generated from GTL2 and has been identified as one of the most influential miRNAs due to its role in the deletion of target genes that result in severe defects [PMC5886287]. Specifically, MIR665 targets genes such as Clip2, whose knockout has been associated with growth retardation and lethality [PMC5886287]. In colonic mucosal tissues, MIR665 targets Xbp1 to promote apoptosis and exacerbate colitis in mice [PMC6031203]. It has also been shown to inhibit cell growth effectively in cancer studies [PMC6145696], with its involvement confirmed in prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 is regulated by circRNA_0087207 which acts as a sponge to modulate gene expression related to DNA damage/repair and apoptosis [PMC9027941]. Bioinformatic analyses have revealed that circRNA_0087207 suppresses MIR665 affecting downstream target genes associated with DNA repair and apoptotic cell death in patient-derived cells for Leber's hereditary optic neuropathy (LHON) [PMC9027941]. Additionally, E2F3 mRNA has been identified as a downstream target of MIR665 through binding site analyses and luciferase reporter assays [PMC9701882], while miR526b along with MIR665 have been upregulated by COX-2 overexpression in breast cancer cells [PMC5762661].

Literature search

18 open access papers mention hsa-mir-665
(36 sentences)

Sequence

533 reads, 26 reads per million, 64 experiments

ucuccucgaggggucucugccucuacccaggacucuuucaugACCAGGAGGCUGAGGCCCCUcacaggcggc
.(.(((.((((((((((.((((((...(((((....))).))....)))))).))))))))))..))).)..

Structure

-u u   -c          u      -acc  -   c 
  c ccu  gaggggucuc gccucu    ca gga u
  | |||  |||||||||| ||||||    || |||  
  g gga  cUCCCCGGAG CGGAGG    gu cuu c
cg c   ca          U      ACCA  a   u 

Annotation confidence Not enough data

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr14: 100875033-100875104 [+]

Clustered miRNAs

7 other miRNAs are < 10 kb from hsa-mir-665

Disease association

hsa-mir-665 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-665

• Accession: MIMAT0004952
• Description: Homo sapiens hsa-miR-665 mature miRNA
• Sequence: 43 - ACCAGGAGGCUGAGGCCCCU - 62
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298