WARNING: This summary was generated by AI. MIR708 is a microRNA whose expression levels were analyzed using boxplot diagrams, leading to the exclusion of eight outliers to ensure the accuracy of the data presented [PMC6961682]. The study further demonstrated that transfection with MIR708 mimics resulted in enhanced binding of MIR708 to the Argonaute 2 (Ago2) protein, a key component in RNA-induced silencing complex (RISC) that plays a crucial role in microRNA-mediated gene silencing [PMC10067432]. Additionally, knockdown of circEZH2E2/E3 was shown to decrease its own retrieval while concurrently increasing the binding affinity of MIR708 to Ago2, suggesting a competitive relationship between circEZH2E2/E3 and MIR708 for Ago2 binding [PMC10067432].
-aa A A C GGg aa ac cugcccuc AGGAGCUUACA UCUAG UG gu aug u |||||||| ||||||||||| ||||| || || ||| u gacgggaG UCUUCGAGUGU AGAUC AC ca uac g agg A C A --a ag ac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004926 |
| Description | Homo sapiens hsa-miR-708-5p mature miRNA |
| Sequence | 11 - AAGGAGCUUACAAUCUAGCUGGG - 33 |
| Evidence |
experimental
cloned [1-2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004927 |
| Description | Homo sapiens hsa-miR-708-3p mature miRNA |
| Sequence | 57 - CAACUAGACUGUGAGCUUCUAG - 78 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|