MIR876 is a gene encoding for microRNAs, specifically miR-876–3p and miR-876–5p, which are implicated in the regulation of bone geometry and appendicular lean mass (ALM) [PMC3210160]. In a bivariate genome-wide association study (GWAS) conducted among Chinese individuals, MIR876, along with MIR873, was associated with femoral neck bone geometry and ALM [PMC3210160]. This study identified a cluster of 11 single nucleotide polymorphisms (SNPs) within the genomic regions of MIR876 and MIR873 that showed a strong association with ALM-BR in the Chinese population [PMC3210160]. Notably, two of these SNPs are located in the promoter region of MIR876 [PMC3210160]'>PMC3210160], which could suggest potential regulatory effects on gene expression. However, these associations were not replicated in US Caucasians [PMC3706967], indicating possible ethnic differences in genetic susceptibility. The exact biological mechanisms by which MIR876 influences bone and muscle metabolism remain to be elucidated [PMC3210160]. Additionally, research has identified miR-876-3p as a methylation-sensitive microRNA that could be involved in gene regulation through epigenetic modifications [PMC9582525]. In certain glioblastomas (pGBMs), deletions at 9p21.3 that include the MIR876 gene have been observed as well [PMC6388501], suggesting its potential role in disease pathology.
U au uaa ugaagugcugUGGAUU CUUUGUGAAUCACCAu c g |||||||||||||||| |||||||||||||||| | c acuucgugauACUUAA GAAACAUUUGGUGGUg g u U gu uaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004924 |
Description | Homo sapiens hsa-miR-876-5p mature miRNA |
Sequence | 11 - UGGAUUUCUUUGUGAAUCACCA - 32 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004925 |
Description | Homo sapiens hsa-miR-876-3p mature miRNA |
Sequence | 50 - UGGUGGUUUACAAAGUAAUUCA - 71 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|