miRBase entry: hsa-mir-765

Stem-loop hsa-mir-765


Accession
MI0005116
Symbol
HGNC: MIR765
Description
Homo sapiens hsa-mir-765 precursor miRNA mir-765
Gene
family?
RF01027; mir-765

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR765 is a microRNA that has been identified as consistently down-regulated across all central nervous system (CNS) tumor samples, suggesting its potential as a diagnostic marker for these tumors [PMC8235499]. This miRNA, along with others, has been found to significantly alter the expression of genes involved in cancer pathways, indicating its role in the molecular mechanisms of cancer [PMC8229109]. The inhibition of miR-765 through the transfection of a MIR765 inhibitor has been shown to suppress proliferation, migration, and invasion in non-small cell lung cancer (NSCLC) cells [PMC8349552]. Moreover, MIR765 is located within a region that is amplified in malignant melanoma (MM), suggesting its possible involvement in melanomagenesis [PMC4619539]. It is also consistent across different procedures and has been implicated in various cancers including liver, prostate, and bone cancers [PMC5025515; PMC8191793].. Additionally, MIR765 interacts with circular RNAs that can regulate the expression of target genes such as GALNT2 within peripheral blood mononuclear cells (PBMCs) of patients with IgA nephropathy (IgAN), further highlighting its regulatory capacity [PMC7719294].

Literature search
17 open access papers mention hsa-mir-765
(58 sentences)

Sequence

299 reads, 53 reads per million, 58 experiments
uuuaggcgcugaugaaaguggaguucaguagacagcccuuuucaagcccuacgagaaacugggguuucUGGAGGAGAAGGAAGGUGAUGaaggaucuguucucgugagccugaa
.((((((.((((.(((.......((((....((...(((((((((((((((........))))))))......)))))))...))..)))).......)))))).).)))))).

Structure
u      g -   u   aguggag    guag  agc       ------        cga 
 uuaggc c uga gaa       uuca    ac   ccuuuuc      aagcccua   g
 |||||| | ||| |||       ||||    ||   |||||||      ||||||||    
 aguccg g gcu cuu       aaGU    UG   GGAAGAG      uuuggggu   a
a      a u   -   gucuagg    --AG  GAA       GAGGUc        caa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 156936131-156936244 [-]

Disease association
hsa-mir-765 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-765

Accession MIMAT0003945
Description Homo sapiens hsa-miR-765 mature miRNA
Sequence 69 - UGGAGGAGAAGGAAGGUGAUG - 89
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298