Stem-loop mdv1-mir-M1

Accession

MI0005093

Description

Mareks disease virus type 1 mdv1-mir-M1 precursor miRNA

Sequence

uuccccuuuUGCUUGUUCACUGUGCGGCAuuauuacauuuacaccgguaaUGCUGCGCAUGAAAGAGCGAacggaa
....((.(((((((.((((.((((((((((((((...........)))))))))))))))))).))))))).))..

Structure

uucc  u       G    C              acau 
    cc uuUGCUU UUCA UGUGCGGCAuuauu    u
    || ||||||| |||| ||||||||||||||    u
    gg aAGCGAG AAGU ACGCGUCGUaaugg    a
--aa  c       A    -              ccac 

Annotation confidence Not enough data

Genome context

AF243438.1: 4681-4756 [-]

Clustered miRNAs

8 other miRNAs are < 10 kb from mdv1-mir-M1

Mature mdv1-miR-M1-5p

• Accession: MIMAT0003920
• Description: Mareks disease virus type 1 mdv1-miR-M1-5p mature miRNA
• Sequence: 10 - UGCUUGUUCACUGUGCGGCA - 29
• Evidence: experimental ; cloned [1-3], Northern [1], Illumina [4]

Mature mdv1-miR-M1-3p

• Accession: MIMAT0005801
• Description: Mareks disease virus type 1 mdv1-miR-M1-3p mature miRNA
• Sequence: 51 - UGCUGCGCAUGAAAGAGCGA - 70
• Evidence: experimental ; cloned [2], Northern [2], Illumina [4]

References

1. PubMed ID: 18256158
   MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs
   "Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V"
   "J Virol (2008) 82:4007-4015


2. PubMed ID: 16912324
   Marek's disease virus encodes MicroRNAs that map to meq and the latency-associated transcript
   "Burnside J, Bernberg E, Anderson A, Lu C, Meyers BC, Green PJ, Jain N, Isaacs G, Morgan RW"
   "J Virol (2006) 80:8778-8786


3. PubMed ID: 18430245
   Deep sequencing of chicken microRNAs
   Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW
   BMC Genomics (2008) 9:185


4. PubMed ID: 18842708
   Sequence conservation and differential expression of Marek's disease virus microRNAs
   "Morgan R, Anderson A, Bernberg E, Kamboj S, Huang E, Lagasse G, Isaacs G, Parcells M, Meyers BC, Green PJ, Burnside J"
   "J Virol (2008) 82:12213-12220