Stem-loop hsa-mir-378d-2

Accession

MI0003840

Symbol

HGNC: MIR378D2

Description

Homo sapiens hsa-mir-378d-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR378D2 is a human microRNA located on a different chromosome than its counterpart MIR378D1 and is notably expressed in a variety of cell lines, with particularly high expression in esophageal cell lines [PMC8697470]. This microRNA, along with LINC00665, has been implicated in the regulation of genes involved in the ubiquitin-dependent protein catabolic process and the neurotrophin signaling pathway [PMC6012059]. Furthermore, MIR378D2 and LINC00665 together influence genes that are involved in ubiquitin-dependent protein catabolism and the cellular response to calcium ions [PMC6012059]. In a study examining differentially expressed genes (DEGs), MIR378D2 was found to coregulate 55 DEGs alongside LINC00665, highlighting its role in gene regulation [PMC6012059].

Literature search

194 open access papers mention hsa-mir-378d-2
(924 sentences)

Sequence

858641 reads, 2910 reads per million, 123 experiments

gaaugguuacaaggagagaacACUGGACUUGGAGUCAGAAAacuuucauccaagucauucccugcucuaagucccauuucuguuccaugagauuguuu
((((((((.((.((((((((....((((((((((.(((...((((......))))......)))))))))))))...)))).)))).)).))))))))

Structure

        a  a    -    cACU          U   ---AAA    uc 
gaaugguu ca ggag agaa    GGACUUGGAG CAG      acuu  a
|||||||| || |||| ||||    |||||||||| |||      ||||   
uuuguuag gu ccuu ucuu    ccugaaucuc guc      ugaa  u
        a  a    g    -uac          -   ccuuac    cc 

Annotation confidence Low

Genome context

chr8: 93916022-93916119 [-]

Mature hsa-miR-378d

• Accession: MIMAT0018926
• Description: Homo sapiens hsa-miR-378d mature miRNA
• Sequence: 22 - ACUGGACUUGGAGUCAGAAA - 41
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


2. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127