WARNING: This summary was generated by AI. MIR454 is a microRNA implicated in various biological processes and diseases, including cancer [PMC6659797]. It is part of the MIR130 family, which shares a common seed sequence and can target common sequences [PMC6659797]. Despite its initial identification as one of the most stably expressed miRNAs in colorectal tissues, MIR454 was excluded from subsequent in vitro studies [PMC2873395][PMC6659797[PMC6659797]. It has been shown to directly target TSPAN1 and FAM83A, suggesting its involvement in cancer progression [PMC8533140]. Overexpression of MIR454 has been associated with advanced clinical stages and poor prognosis in gastric cancer patients [PMC7185177]. Conversely, it was found to be downregulated in lymphoma-associated miRNA studies with significant fold changes indicating its potential as a tumor suppressor [PMC7782091][PMC6194144[PMC6194144]. In the context of frailty, altered expression patterns including MIR454 have been identified as potential biomarkers associated with senescence pathways [PMC8980209]. Furthermore, differential expression of MIR454 has been observed in glioblastoma and bladder tumors, suggesting its role varies across different types of cancers [PMC8470251][PMC7920560[PMC7920560].
u ---- --a c --- ---- --U g cuguuua uc ccagau cuagaACCCUAU CAAUAUUGU CUC GCugu u ||||||| || |||||| |||||||||||| ||||||||| ||| ||||| gacgggu ag gguuug gguuuUGGGAUA GUUAUAACG gag ugaua a g aaca aaa u UUC UGAU ucu a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003884 |
| Description | Homo sapiens hsa-miR-454-5p mature miRNA |
| Sequence | 24 - ACCCUAUCAAUAUUGUCUCUGC - 45 |
| Evidence |
experimental
cloned [1-2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0003885 |
| Description | Homo sapiens hsa-miR-454-3p mature miRNA |
| Sequence | 64 - UAGUGCAAUAUUGCUUAUAGGGU - 86 |
| Evidence |
experimental
cloned [1-2] |
| Database links |
|
| Predicted targets |
|
|