miRBase entry: hsa-mir-454

Stem-loop hsa-mir-454


Accession
MI0003820
Symbol
HGNC: MIR454
Description
Homo sapiens hsa-mir-454 precursor miRNA mir-454
Gene
family?
RF00746; mir-454

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR454 is a microRNA implicated in various biological processes and diseases, including cancer [PMC6659797]. It is part of the MIR130 family, which shares a common seed sequence and can target common sequences [PMC6659797]. Despite its initial identification as one of the most stably expressed miRNAs in colorectal tissues, MIR454 was excluded from subsequent in vitro studies [PMC2873395][PMC6659797[PMC6659797]. It has been shown to directly target TSPAN1 and FAM83A, suggesting its involvement in cancer progression [PMC8533140]. Overexpression of MIR454 has been associated with advanced clinical stages and poor prognosis in gastric cancer patients [PMC7185177]. Conversely, it was found to be downregulated in lymphoma-associated miRNA studies with significant fold changes indicating its potential as a tumor suppressor [PMC7782091][PMC6194144[PMC6194144]. In the context of frailty, altered expression patterns including MIR454 have been identified as potential biomarkers associated with senescence pathways [PMC8980209]. Furthermore, differential expression of MIR454 has been observed in glioblastoma and bladder tumors, suggesting its role varies across different types of cancers [PMC8470251][PMC7920560[PMC7920560].

Literature search
39 open access papers mention hsa-mir-454
(284 sentences)

Sequence

55772 reads, 224 reads per million, 117 experiments
ucuguuuaucaccagauccuagaACCCUAUCAAUAUUGUCUCUGCuguguaaauaguucugagUAGUGCAAUAUUGCUUAUAGGGUuuugguguuuggaaagaacaaugggcagg
.(((((((((.((((((.((((((((((((((((((((((((.(((((....)))))...)))....)))))))))...)))))))))))).))))))...))....))))))).

Structure
u       ----  --a      c            ---         ----   --U     g 
 cuguuua    uc   ccagau cuagaACCCUAU   CAAUAUUGU    CUC   GCugu u
 |||||||    ||   |||||| ||||||||||||   |||||||||    |||   |||||  
 gacgggu    ag   gguuug gguuuUGGGAUA   GUUAUAACG    gag   ugaua a
g       aaca  aaa      u            UUC         UGAU   ucu     a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature miRNA sequences were named miR-454-5p and miR-454-3p in [1] and here. Landgraf et al. showed that the 3' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr17: 59137758-59137872 [-]

Disease association
hsa-mir-454 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-454-5p

Accession MIMAT0003884
Description Homo sapiens hsa-miR-454-5p mature miRNA
Sequence 24 - ACCCUAUCAAUAUUGUCUCUGC - 45
Evidence experimental
cloned [1-2]
Database links
Predicted targets

Mature hsa-miR-454-3p

Accession MIMAT0003885
Description Homo sapiens hsa-miR-454-3p mature miRNA
Sequence 64 - UAGUGCAAUAUUGCUUAUAGGGU - 86
Evidence experimental
cloned [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298