MIR1296 is a microRNA that is involved in the serotonin-mediated signaling pathway regulating myogenic differentiation [PMC8396502]. In a study using NanoString technology, it was found that MIR1296, along with other miRNAs such as miR3185, miR28, miR182, and miR614, showed significant changes in their levels with pre-shift/post-shift or change with PoMS subscales TMD or FI [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 was found to be downregulated in the cortex of AD patients [PMC7564652]. Additionally, MIR129-2 and MIR219A1 were also downregulated in AD patients' cortex [PMC7564652]. On the other hand, MIR199A2 and MIR92A1 were upregulated in AD patients' cortex [PMC7564652]. The dysregulation of MIR129-2, MIR219A1, and other miRNAs such as MIR29B1 and MIR199A2 has been previously reported in AD patients and was confirmed by this study [PMC7564652]. However, for some miRNAs like MIR129-2, MIR1296, and MIR99A that were found to be dysregulated in AD patients' cortex by this study as well as previous studies. The specific pathways or targets associated with these dysregulations have not been identified yet [PMC7564652].
---a aacu CCCU U ua a ccuaccu gggUUAGGG GGCUCCA CUCCuu ggaa a ||||||| ||||||||| ||||||| |||||| |||| gggugga cCCAAUCCC UCGGGGU GAGggg ucuu c uguc ---- AGCU - ug c
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005794 |
Description | Homo sapiens hsa-miR-1296-5p mature miRNA |
Sequence | 16 - UUAGGGCCCUGGCUCCAUCUCC - 37 |
Evidence |
experimental
Illumina [2,4], 454 [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026637 |
Description | Homo sapiens hsa-miR-1296-3p mature miRNA |
Sequence | 59 - GAGUGGGGCUUCGACCCUAACC - 80 |
Evidence |
experimental
Illumina [4] |
|