MIR671 is a microRNA implicated in various biological processes and diseases, including immune response and retinal degeneration [PMC8362665]. It is contained within EpCAM-Exos and is associated with several novel miRNAs [PMC5137021]. Studies have shown that MIR671, along with other genes, is upregulated in response to increased macrophage/microglia activity as retinal degeneration progresses [PMC8362665], [PMC4872275]. It also appears to regulate extracellular matrix production and can act as a sponge for target transcripts, although it can be cleaved by other miRNAs [PMC4872275], [PMC9918958]. In the context of preeclampsia, MIR671 is among the miRNAs that are significantly increased, contributing to various pathological conditions such as renal fibrosis and inflammatory processes [PMC5933288]. Additionally, MIR671 has been identified within upregulated genes in non-protein coding regions associated with intragenic miRNAs that are implicated in downregulation or upregulation of certain cellular processes [PMC5823624].
ggu aa ----a a A A GA u ug gca g cuggc ggcc ggaagagg GGA GCCCUG GGGGCUGGAGg ga g ||| | ||||| |||| |||||||| ||| |||||| ||||||||||| || a cgu c gaccg ccgg cuuucuCC CCU CGGGAC UCUUGGCCUcc uu u ggu gg agaug g A - -- u ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003880 |
Description | Homo sapiens hsa-miR-671-5p mature miRNA |
Sequence | 29 - AGGAAGCCCUGGAGGGGCUGGAG - 51 |
Evidence |
experimental
cloned [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004819 |
Description | Homo sapiens hsa-miR-671-3p mature miRNA |
Sequence | 68 - UCCGGUUCUCAGGGCUCCACC - 88 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|