MIR758 is a microRNA (miRNA) that has been studied in the context of its expression in relation to certain treatments and its location within the genome. Treatment with a specific agent for 24 hours was found to reduce the expression of several miRNAs, including MIR758, as shown by qRT-PCR results [PMC6100038]. MIR758, along with other miRNAs, has been identified as having a role in inhibiting the expression or function of the ATP-binding cassette transporter A1 (ABCA1) [PMC6100038]. However, there is no evidence provided that MIR758 expression is associated with cellular processes such as proliferation and differentiation, nor that it has been implicated in neuroblastoma progression [PMC9866967]. In canine genomes, MIR758 is notably located within a cluster of differentially expressed (DE) miRNAs on chromosome 8 [PMC8376273]. This cluster includes several other miRNAs that have been profiled for their expression levels [PMC10148110].
-gcc a --A U A -A C - uuu uggauac ugaG UGGU GACCAG G GCA ACg c a ||||||| |||| |||| |||||| | ||| ||| | u aucuaug acuc AUCA CUGGUC C UGU Ugc g u cgua - CCA C - AG U c ugu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003879 |
Description | Homo sapiens hsa-miR-758-3p mature miRNA |
Sequence | 52 - UUUGUGACCUGGUCCACUAACC - 73 |
Evidence |
experimental
cloned [1-2], SOLiD [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0022929 |
Description | Homo sapiens hsa-miR-758-5p mature miRNA |
Sequence | 15 - GAUGGUUGACCAGAGAGCACAC - 36 |
Evidence |
experimental
SOLiD [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|