MicroRNA 421 (MIR421) is a non-coding RNA molecule that plays a significant role in various biological processes, including cancer progression and the body's response to oxidative stress [PMC7802300; PMC9313271].. In gastric cancer, MIR421 levels in gastric juice are notably different from those in benign gastric diseases [PMC6924079]. MIR421, along with MIR27a-3p and hemoglobin levels in feces, has been utilized to develop a model that accurately identifies patients with colorectal cancer (CRC), demonstrating superior diagnostic performance compared to fecal hemoglobin concentration alone [PMC9318064]. Additionally, MIR421 has been implicated in the negative regulation of the ACE2 receptor by targeting its 3′-UTR [PMC7653219], and its overexpression is associated with increased proliferation of cancer cells in breast and non-small cell lung cancers [PMC7802300]. Furthermore, MIR421 is part of a three-miRNA signature that predicts gastrointestinal (GI) involvement and clinical outcomes [PMC7802300]'>PMC7802300], and it has been shown to interfere with DNA repair by suppressing ataxia-telangiectasia mutated expression, thereby enhancing GI [PMC7802300]. Despite its oncogenic role in various cancers, MIR421 may also act as a tumor suppressor in certain contexts such as prostate cancer cells [PMC6089101], illustrating its complex role in oncogenesis.
----g uu - uua a aaa caca guaggc cuca aauguuuguuga uga a |||| |||||| |||| |||||||||||| ||| a gugu cgucCG GGGU UUACAGACAACU Acu u cucua cu C UAA - aag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003339 |
Description | Homo sapiens hsa-miR-421 mature miRNA |
Sequence | 48 - AUCAACAGACAUUAAUUGGGCGC - 70 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|