MIR652 is a microRNA that has been observed to have varying expression levels in different biological contexts and diseases. In the subgroup of early-onset myasthenia gravis (EOMG), MIR652 was found to be expressed at low levels [PMC3956820]. In contrast, in both knockout (KO) and knock-in (KI) mouse models, MIR652 was upregulated, which has been associated with the negative regulation of spermatid differentiation [PMC10001410]. In the case of breast cancer, MIR652 expression was generally lower in serum samples from cancer cases compared to controls [PMC9967215]. Furthermore, MIR652 has been identified as a potential biomarker for breast cancer in at least two independent clinical studies that analyzed serum, plasma, or whole blood samples [PMC9967215]. Kaplan-Meier analysis included MIR652 as part of a four-miRNA signature that could help predict tumor relapse and overall survival (OS) in patients with triple-negative breast cancer (TNBC), suggesting its potential prognostic value [PMC7392022].
acgaau cua GAGAG ca g gg ugcacugcaCAACCCUAG GGUGCCAUUCA ua a || |||||||||||||||||| ||||||||||| || c cc acgugacGUGUUGGGAUC CCGCGGUAAgu au u -cacau aac ----A ua a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003322 |
Description | Homo sapiens hsa-miR-652-3p mature miRNA |
Sequence | 61 - AAUGGCGCCACUAGGGUUGUG - 81 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022709 |
Description | Homo sapiens hsa-miR-652-5p mature miRNA |
Sequence | 21 - CAACCCUAGGAGAGGGUGCCAUUCA - 45 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|