Stem-loop hsa-mir-642a

Accession

MI0003657

Symbol

HGNC: MIR642A

Description

Homo sapiens hsa-mir-642a precursor miRNA mir-642

Gene
family

RF00963; mir-642

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR642A is a microRNA implicated in the regulation of DEPTOR expression in multiple myeloma (MM) cells [PMC5395780]. The expression of MIR642A, along with miR135b, is downregulated in MM, and this downregulation is associated with DEPTOR overexpression [PMC5395780]. Inhibition of MIR642A leads to an increase in DEPTOR levels, suggesting a regulatory relationship [PMC5395780]. Transfection experiments have shown that MIR642A can decrease DEPTOR levels and affect the cellular phenotype by producing smaller and rounder cells with reduced cytoplasm and endoplasmic reticulum content [PMC5395780'>PMC5395780]. The direct targeting of DEPTOR by MIR642A was confirmed through luciferase reporter assays, which demonstrated reduced luciferase activity when myeloma cells were cotransfected with MIR642A and a reporter plasmid containing the DEPTOR 3′UTR [PMC5395780]. These findings suggest that the modulation of DEPTOR by MIR642A may play a role in the pathophysiology of MM [PMC5395780]. Additionally, hypermethylation at the MIR642A locus has been observed in certain cancer cell lines, indicating an epigenetic mechanism that may contribute to its downregulation [PMC3245283].

Literature search

9 open access papers mention hsa-mir-642a
(64 sentences)

Sequence

1444 reads, 75 reads per million, 92 experiments

aucugaguugggaggGUCCCUCUCCAAAUGUGUCUUGgggugggggaucaAGACACAUUUGGAGAGGGAACCucccaacucggccucugccaucauu
....(((((((((((.((((((((((((((((((((((.........)))))))))))))))))))))).)))))))))))(((....)))......

Structure

------------aucu           G                      ggu 
                gaguugggagg UCCCUCUCCAAAUGUGUCUUGg   g
                ||||||||||| ||||||||||||||||||||||   g
                cucaacccuCC AGGGAGAGGUUUACACAGAacu   g
uuacuaccgucuccgg           A                      agg 

Annotation confidence High

Genome context

chr19: 45674928-45675024 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-642a

Disease association

hsa-mir-642a is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-642a-5p

• Accession: MIMAT0003312
• Description: Homo sapiens hsa-miR-642a-5p mature miRNA
• Sequence: 16 - GUCCCUCUCCAAAUGUGUCUUG - 37
• Evidence: experimental ; RT-PCR [1], SAGE [1], cloned [2]

Mature hsa-miR-642a-3p

• Accession: MIMAT0020924
• Description: Homo sapiens hsa-miR-642a-3p mature miRNA
• Sequence: 51 - AGACACAUUUGGAGAGGGAACC - 72
• Evidence: experimental ; SOLiD [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692


3. PubMed ID: 21767385
   Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis
   Zaragosi LE, Wdziekonski B, Brigand KL, Villageois P, Mari B, Waldmann R, Dani C, Barbry P
   Genome Biol (2011) 12:R64