miRBase entry: hsa-mir-642a

Stem-loop hsa-mir-642a


Accession
MI0003657
Symbol
HGNC: MIR642A
Description
Homo sapiens hsa-mir-642a precursor miRNA mir-642
Gene
family?
RF00963; mir-642

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR642A is a microRNA implicated in the regulation of DEPTOR expression in multiple myeloma (MM) cells [PMC5395780]. The expression of MIR642A, along with miR135b, is downregulated in MM, and this downregulation is associated with DEPTOR overexpression [PMC5395780]. Inhibition of MIR642A leads to an increase in DEPTOR levels, suggesting a regulatory relationship [PMC5395780]. Transfection experiments have shown that MIR642A can decrease DEPTOR levels and affect the cellular phenotype by producing smaller and rounder cells with reduced cytoplasm and endoplasmic reticulum content [PMC5395780'>PMC5395780]. The direct targeting of DEPTOR by MIR642A was confirmed through luciferase reporter assays, which demonstrated reduced luciferase activity when myeloma cells were cotransfected with MIR642A and a reporter plasmid containing the DEPTOR 3′UTR [PMC5395780]. These findings suggest that the modulation of DEPTOR by MIR642A may play a role in the pathophysiology of MM [PMC5395780]. Additionally, hypermethylation at the MIR642A locus has been observed in certain cancer cell lines, indicating an epigenetic mechanism that may contribute to its downregulation [PMC3245283].

Literature search
9 open access papers mention hsa-mir-642a
(64 sentences)

Sequence

1002 reads, 11 reads per million, 91 experiments
aucugaguugggaggGUCCCUCUCCAAAUGUGUCUUGgggugggggaucaAGACACAUUUGGAGAGGGAACCucccaacucggccucugccaucauu
....(((((((((((.((((((((((((((((((((((.........)))))))))))))))))))))).)))))))))))(((....)))......

Structure
------------aucu           G                      ggu 
                gaguugggagg UCCCUCUCCAAAUGUGUCUUGg   g
                ||||||||||| ||||||||||||||||||||||   g
                cucaacccuCC AGGGAGAGGUUUACACAGAacu   g
uuacuaccgucuccgg           A                      agg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 45674928-45675024 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-642a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-642a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-642a-5p

Accession MIMAT0003312
Description Homo sapiens hsa-miR-642a-5p mature miRNA
Sequence 16 - GUCCCUCUCCAAAUGUGUCUUG - 37
Evidence experimental
RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-642a-3p

Accession MIMAT0020924
Description Homo sapiens hsa-miR-642a-3p mature miRNA
Sequence 51 - AGACACAUUUGGAGAGGGAACC - 72
Evidence experimental
SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 21767385
    Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis
    Zaragosi LE, Wdziekonski B, Brigand KL, Villageois P, Mari B, Waldmann R, Dani C, Barbry P
    Genome Biol (2011) 12:R64