Stem-loop hsa-mir-33b

Accession

MI0003646

Symbol

HGNC: MIR33B

Description

Homo sapiens hsa-mir-33b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR33B is a microRNA with a tumor suppressor role, typically under-expressed in multiple myeloma (MM) patients [PMC5721125]. It is located in the intron 17 of the SREBF-1 gene locus in humans, and this gene is absent in rodents [PMC3639327]. When overexpressed, MIR33B inhibits tumor growth and enhances survival in MM xenograft mouse models by inducing apoptosis through the suppression of proto-oncogene PIM-1 [PMC5721125][PMC7236745[PMC7236745]. MIR33B expression is influenced by lipid metabolism and can be regulated by statins like pitavastatin, which prevents its suppression by oxidized low-density lipoprotein (oxLDL) [PMC4945056]. It also plays a role in reducing metastasis and the epithelial-mesenchymal transition phenotype, with its silencing reversing cordycepin-mediated effects [PMC4496401]. Additionally, MIR33B expression can be epigenetically suppressed by PRMT5, which promotes lymphoma cell growth and survival through silencing tumor-suppressing miRNAs including MIR33B [PMC10147102][PMC10044308][PMC10044308]. In metabolic contexts, MIR33B has been associated with lipid homeostasis regulation alongside its host gene SREBF-1 and has been found to be upregulated in familial hypercholesterolemia cases, correlating with LDL cholesterol levels [PMC5113745][PMC3359973][PMC5085653[PMC3359973][PMC5085653].

Literature search

121 open access papers mention hsa-mir-33b
(1295 sentences)

Sequence

9053 reads, 221 reads per million, 86 experiments

gcgggcggccccgcgGUGCAUUGCUGUUGCAUUGCacgugugugaggcgggugCAGUGCCUCGGCAGUGCAGCCCggagccggccccuggcaccac
(((((((((.(((.((((((((((((..(((((((((.(((.....))).)))))))))..)))))))))).))))).))).))))...)).....

Structure

-----  ---    -   c   c  -          UU         g   g 
     gc   gggc ggc ccg gG UGCAUUGCUG  GCAUUGCac ugu u
     ||   |||| ||| ||| || ||||||||||  ||||||||| ||| g
     cg   cccg ccg ggC CC ACGUGACGGC  CGUGACgug gcg a
cacca  guc    g   a   -  G          UC         g   g 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr17: 17813836-17813931 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-33b

Biological pathways

hsa-mir-33b is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-33b is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-33b-5p

• Accession: MIMAT0003301
• Description: Homo sapiens hsa-miR-33b-5p mature miRNA
• Sequence: 16 - GUGCAUUGCUGUUGCAUUGC - 35
• Evidence: experimental ; SAGE [1], cloned [2]

Mature hsa-miR-33b-3p

• Accession: MIMAT0004811
• Description: Homo sapiens hsa-miR-33b-3p mature miRNA
• Sequence: 54 - CAGUGCCUCGGCAGUGCAGCCC - 75
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692