Stem-loop hsa-mir-627

Accession

MI0003641

Symbol

HGNC: MIR627

Description

Homo sapiens hsa-mir-627 precursor miRNA mir-627

Gene
family

RF03831; mir-627

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR627 is a microRNA whose expression is influenced by the cellular environment, particularly under hypoxic conditions, as observed in hepatocellular carcinoma (HCC) cells [PMC8317525]. Research using ChIP assays with an H3K9ac antibody revealed that hypoxia leads to a decrease in H3 acetylation at the MIR627 promoter region, which correlates with the downregulation of MIR627 [PMC8317525]. This downregulation of MIR627 under hypoxia is dependent on HIF-1α; however, it does not occur through direct binding of HIF-1α to hypoxia-response elements (HRE) in the MIR627 promoter [PMC8317525]. Additionally, it was found that knockdown of HDAC3, an enzyme involved in histone deacetylation, results in increased acetylation and expression of MIR627, suggesting that HDAC3 plays a critical role in the repression of miR-627-5p during hypoxic conditions [PMC8317525'>PMC8317525]. Despite potential binding sites for HIF-1α on the MIR627 promoter region being identified and tested using ChIP and luciferase assays, no direct transcriptional activation by HIF-1α through these sites was observed [PMC8317525]. This indicates that miR-627-5p repression is mediated by mechanisms other than direct interaction with its promoter's HRE sites during hypoxia [PMC8317525].

Literature search

10 open access papers mention hsa-mir-627
(15 sentences)

Sequence

2945 reads, 13 reads per million, 96 experiments

uacuuauuacugguaGUGAGUCUCUAAGAAAAGAGGAggugguuguuuuccuccUCUUUUCUUUGAGACUCACUaccaauaauaagaaauacuacua
..(((((((.((((((((((((((.((((((((((((((.((....)).)))))))))))))).)))))))))))))).)))))))...........

Structure

---------ua       c              U              u  u 
           cuuauua ugguaGUGAGUCUC AAGAAAAGAGGAgg gg u
           ||||||| |||||||||||||| |||||||||||||| ||  
           gaauaau accaUCACUCAGAG UUCUUUUCUccucc uu g
aucaucauaaa       a              U              u  u 

Annotation confidence High

Genome context

chr15: 42199570-42199666 [-]

Disease association

hsa-mir-627 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-627-5p

• Accession: MIMAT0003296
• Description: Homo sapiens hsa-miR-627-5p mature miRNA
• Sequence: 16 - GUGAGUCUCUAAGAAAAGAGGA - 37
• Evidence: experimental ; SAGE [1], cloned [2]

Mature hsa-miR-627-3p

• Accession: MIMAT0026623
• Description: Homo sapiens hsa-miR-627-3p mature miRNA
• Sequence: 55 - UCUUUUCUUUGAGACUCACU - 74
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692


3. PubMed ID: 23226537
   The repertoire and features of human platelet microRNAs
   Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
   PLoS One (2012) 7:e50746