MIR615 is a microRNA encoded within the HOXC cluster on chromosome 13 and is implicated in various cancers, including prostate, colon, and osteosarcoma (OS) [PMC4620477][PMC3037319][PMC9441498'>PMC4620477][PMC3037319][PMC9441498[PMC3037319][PMC9441498]. It consists of two microRNAs, MIR615-5p and MIR615-3p [PMC4620477]. In OS patient tissues, MIR615 was significantly downregulated and associated with poor clinical outcomes [PMC9441498]. The gene's epigenetic regulation is a novel discovery, with its location in a high CpG density region suggesting potential epigenetic regulation mechanisms [PMC3037319]. Research involving CRISPR/Cas9 technology targeted the MIR615-3p-encoding region for gene editing to study its function in cancer cells [PMC4620477]. Overexpression of MIR615 has been shown to inhibit cell proliferation, migration, and invasion in vitro [PMC10057657]], indicating its potential role as a tumor suppressor. Additionally, changes in the expression of MIR615 have been observed in various studies involving miRNA-gene networks and miRNA expression profiles across different conditions [PMC5611503][PMC9702351][PMC5234833[PMC9702351][PMC5234833].
                            cuc ag c -UC U Cu g ug ggg ggg gggagGGGGG CCCGG GCUCGGAU cgag g c ||| ||| |||||||||| ||||| |||||||| |||| | u ccc ccc cccUUCUCCC GGGUC CGAGCCUg gcuu u u ccc aa - UCU - -- g ua
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0004804 | 
| Description | Homo sapiens hsa-miR-615-5p mature miRNA | 
| Sequence | 18 - GGGGGUCCCCGGUGCUCGGAUC - 39 | 
| Evidence | 
                                    experimental
                                    
                                     cloned [2]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0003283 | 
| Description | Homo sapiens hsa-miR-615-3p mature miRNA | 
| Sequence | 61 - UCCGAGCCUGGGUCUCCCUCUU - 82 | 
| Evidence | 
                                    experimental
                                    
                                     RT-PCR [1], SAGE [1], cloned [2]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
                        
  |