MIR590 is a microRNA that has been observed to be upregulated in various pathological conditions [PMC7652879]. It is regulated by an ERα binding site in its promoter region, located approximately 1050 bp upstream from its transcription start site [PMC6328622]. MIR590 has been implicated in the regulation of genes associated with synaptic maturation, as well as the modulation of TGFβR2, which is a key player in epithelial-mesenchymal transition (EMT) [PMC9685394], [PMC4626157]. Furthermore, MIR590 has been shown to target Tob1 within exosomes and exert effects that influence cellular processes [PMC9564062]. In cardiovascular research, MIR590 has been identified as an inhibitor of cardiac fibrosis post-myocardial infarction and is closely associated with myocarditis and heart failure (HF) [PMC9589260], [PMC5460483]. It also plays a role in oncogenesis by targeting PPM1F and serves as a prognostic factor for tumor recurrence [PMC8743668]. Additionally, MIR590's involvement in EMT is well-documented alongside other microRNAs like miR182 and miR183 [PMC7575175]. Its expression levels have also been found to be significantly altered in various diseases such as pancreatitis and breast cancer (BRCA), indicating its potential role as a biomarker for these conditions [PMC9599289], [PMC10137353].
--------uagc a G U G ua u cagucaga au AGCUUAU CAUAAAA UGCAG ugg g |||||||| || ||||||| ||||||| ||||| ||| a guuagucu UG UCGAAUA GUAUUUU AUguc acu a acgacguacaaa c A U A ua g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003258 |
Description | Homo sapiens hsa-miR-590-5p mature miRNA |
Sequence | 16 - GAGCUUAUUCAUAAAAGUGCAG - 37 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004801 |
Description | Homo sapiens hsa-miR-590-3p mature miRNA |
Sequence | 56 - UAAUUUUAUGUAUAAGCUAGU - 76 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|