miRBase entry: hsa-mir-590

Stem-loop hsa-mir-590


Accession
MI0003602
Symbol
HGNC: MIR590
Description
Homo sapiens hsa-mir-590 precursor miRNA mir-590
Gene
family?
RF00928; mir-590

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR590 is a microRNA that has been observed to be upregulated in various pathological conditions [PMC7652879]. It is regulated by an ERα binding site in its promoter region, located approximately 1050 bp upstream from its transcription start site [PMC6328622]. MIR590 has been implicated in the regulation of genes associated with synaptic maturation, as well as the modulation of TGFβR2, which is a key player in epithelial-mesenchymal transition (EMT) [PMC9685394], [PMC4626157]. Furthermore, MIR590 has been shown to target Tob1 within exosomes and exert effects that influence cellular processes [PMC9564062]. In cardiovascular research, MIR590 has been identified as an inhibitor of cardiac fibrosis post-myocardial infarction and is closely associated with myocarditis and heart failure (HF) [PMC9589260], [PMC5460483]. It also plays a role in oncogenesis by targeting PPM1F and serves as a prognostic factor for tumor recurrence [PMC8743668]. Additionally, MIR590's involvement in EMT is well-documented alongside other microRNAs like miR182 and miR183 [PMC7575175]. Its expression levels have also been found to be significantly altered in various diseases such as pancreatitis and breast cancer (BRCA), indicating its potential role as a biomarker for these conditions [PMC9599289], [PMC10137353].

Literature search
68 open access papers mention hsa-mir-590
(418 sentences)

Sequence

92304 reads, 996 reads per million, 152 experiments
uagccagucagaaauGAGCUUAUUCAUAAAAGUGCAGuauggugaagucaaucugUAAUUUUAUGUAUAAGCUAGUcucugauugaaacaugcagca
....((((((((.((.(((((((.(((((((.(((((..(((.....)))..))))).))))))).))))))).)).))))))))............

Structure
--------uagc        a  G       U       G     ua   u 
            cagucaga au AGCUUAU CAUAAAA UGCAG  ugg g
            |||||||| || ||||||| ||||||| |||||  ||| a
            guuagucu UG UCGAAUA GUAUUUU AUguc  acu a
acgacguacaaa        c  A       U       A     ua   g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 74191198-74191294 [+]

Disease association
hsa-mir-590 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-590-5p

Accession MIMAT0003258
Description Homo sapiens hsa-miR-590-5p mature miRNA
Sequence 16 - GAGCUUAUUCAUAAAAGUGCAG - 37
Evidence experimental
Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-590-3p

Accession MIMAT0004801
Description Homo sapiens hsa-miR-590-3p mature miRNA
Sequence 56 - UAAUUUUAUGUAUAAGCUAGU - 76
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692