miRBase entry: hsa-mir-589

Stem-loop hsa-mir-589


Accession
MI0003599
Symbol
HGNC: MIR589
Description
Homo sapiens hsa-mir-589 precursor miRNA mir-589
Gene
family?
RF00987; mir-589

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR589 is a microRNA gene located within the fragile chromosomal region 7p22, which is susceptible to gaps and breaks in various cancers [PMC3634031]. This gene has been identified as differentially methylated and expressed in European American (EA) populations in the context of cancer [PMC8453167]. MIR589 is also among several microRNAs overexpressed in breast cancer (BC), suggesting its potential as a biomarker for diagnosis, prognosis, and therapeutic targets [PMC4508501]. Studies have shown that the expression of MIR589 decreases upon treatment with TGFβ1 in human peritoneal mesothelial cells (HPMCs), which has been observed in cells isolated from long-term peritoneal dialysis (PD) patients as well as HMrSV5 cells, with effects noted as early as 12 hours and persisting up to 48 hours [PMC3479401]. However, the role of MIR589 in mediating peritoneal fibrosis in vivo remains to be elucidated [PMC3479401]. Additionally, MIR589 was among the top 10 upregulated microRNAs following IFN-γ stimulation, indicating its responsiveness to inflammatory cytokines [PMC8010072], further emphasizing its potential relevance across various biological processes and disease states.

Literature search
15 open access papers mention hsa-mir-589
(37 sentences)

Sequence

5972 reads, 91 reads per million, 108 experiments
uccagccugugcccagcagccccUGAGAACCACGUCUGCUCUGAGcuggguacugccuguUCAGAACAAAUGCCGGUUCCCAGAcgcugccagcuggcc
.(((((.((......(((((..(((.(((((.(((.((.(((((((.((......)).))))))).)).)))..))))).)))..))))))))))))..

Structure
-u     c  ugccca     cc   A     -A   C  C       u  gu 
  ccagc ug      gcagc  cUG GAACC  CGU UG UCUGAGc gg  a
  ||||| ||      |||||  ||| |||||  ||| || ||||||| ||   
  ggucg ac      cgucg  GAC CUUGG  GUA AC AGACUug cc  c
cc     -  ------     cA   C     CC   A  A       u  gu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 5495819-5495917 [-]

Disease association
hsa-mir-589 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-589-5p

Accession MIMAT0004799
Description Homo sapiens hsa-miR-589-5p mature miRNA
Sequence 24 - UGAGAACCACGUCUGCUCUGAG - 45
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-589-3p

Accession MIMAT0003256
Description Homo sapiens hsa-miR-589-3p mature miRNA
Sequence 61 - UCAGAACAAAUGCCGGUUCCCAGA - 84
Evidence experimental
SAGE [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692