miRBase entry: hsa-mir-574

Stem-loop hsa-mir-574


Accession
MI0003581
Symbol
HGNC: MIR574
Description
Homo sapiens hsa-mir-574 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR574 is a microRNA encoded by the gene ID: 693159, located on human chromosome 4p14, and is involved in a multi-step biogenesis process [PMC9855975]. It has been identified as a novel self-ligand of TLR7, capable of activating plasmacytoid dendritic cells (pDCs) in the context of systemic lupus erythematosus (SLE) when contained within exosomes [PMC9762196]. Additionally, MIR574 has been associated with epigenetic changes, with age-demethylated sites identified within its encoding gene [PMC4396570]. It is also implicated in cancer biology; MIR574 was consistently down-regulated across all central nervous system (CNS) tumor samples and was part of a panel that could distinguish CNS tumors from controls with high diagnostic accuracy [PMC8235499]. Furthermore, MIR574 expression has been observed in neurons and altered in certain cancer types such as gastric, thyroid, and brain cancer [PMC8018161], [PMC9775590]. Gains covering the MIR574 gene have been reported in certain patient samples indicating its potential involvement in disease progression or as a diagnostic marker [PMC9775590]. Lastly, it has been suggested that MIR574 could be involved in the regulation by acting as a target for endogenous miRNA sponges such as LNC473 [PMC7419277].

Literature search
96 open access papers mention hsa-mir-574
(449 sentences)

Sequence

54104 reads, 461 reads per million, 144 experiments
gggaccugcgugggugcgggcgugUGAGUGUGUGUGUGUGAGUGUGUgucgcuccgggucCACGCUCAUGCACACACCCACAcgcccacacucagg
........(.((((((.(((((((((.(.(((((((((((((((((.(.(.(....)).)))))))))))))))))))))))))))).)))))).)

Structure
gggaccug g      c         A U                 U u g u 
        c ugggug gggcgugUG G GUGUGUGUGUGAGUGUG g c c c
        | |||||| ||||||||| | ||||||||||||||||| | | |  
        g acucac cccgcACAC C CACACACGUACUCGCAC c g g c
-------- g      a         - -                 - u - g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr4: 38868032-38868127 [+]

Disease association
hsa-mir-574 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-574-5p

Accession MIMAT0004795
Description Homo sapiens hsa-miR-574-5p mature miRNA
Sequence 25 - UGAGUGUGUGUGUGUGAGUGUGU - 47
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-574-3p

Accession MIMAT0003239
Description Homo sapiens hsa-miR-574-3p mature miRNA
Sequence 61 - CACGCUCAUGCACACACCCACA - 82
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692