Stem-loop hsa-mir-574

Accession

MI0003581

Symbol

HGNC: MIR574

Description

Homo sapiens hsa-mir-574 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR574 is a microRNA encoded by the gene ID: 693159, located on human chromosome 4p14, and is involved in a multi-step biogenesis process [PMC9855975]. It has been identified as a novel self-ligand of TLR7, capable of activating plasmacytoid dendritic cells (pDCs) in the context of systemic lupus erythematosus (SLE) when contained within exosomes [PMC9762196]. Additionally, MIR574 has been associated with epigenetic changes, with age-demethylated sites identified within its encoding gene [PMC4396570]. It is also implicated in cancer biology; MIR574 was consistently down-regulated across all central nervous system (CNS) tumor samples and was part of a panel that could distinguish CNS tumors from controls with high diagnostic accuracy [PMC8235499]. Furthermore, MIR574 expression has been observed in neurons and altered in certain cancer types such as gastric, thyroid, and brain cancer [PMC8018161], [PMC9775590]. Gains covering the MIR574 gene have been reported in certain patient samples indicating its potential involvement in disease progression or as a diagnostic marker [PMC9775590]. Lastly, it has been suggested that MIR574 could be involved in the regulation by acting as a target for endogenous miRNA sponges such as LNC473 [PMC7419277].

Literature search

96 open access papers mention hsa-mir-574
(449 sentences)

Sequence

54112 reads, 1138 reads per million, 145 experiments

gggaccugcgugggugcgggcgugUGAGUGUGUGUGUGUGAGUGUGUgucgcuccgggucCACGCUCAUGCACACACCCACAcgcccacacucagg
........(.((((((.(((((((((.(.(((((((((((((((((.(.(.(....)).)))))))))))))))))))))))))))).)))))).)

Structure

gggaccug g      c         A U                 U u g u 
        c ugggug gggcgugUG G GUGUGUGUGUGAGUGUG g c c c
        | |||||| ||||||||| | ||||||||||||||||| | | |  
        g acucac cccgcACAC C CACACACGUACUCGCAC c g g c
-------- g      a         - -                 - u - g 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr4: 38868032-38868127 [+]

Disease association

hsa-mir-574 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-574-5p

• Accession: MIMAT0004795
• Description: Homo sapiens hsa-miR-574-5p mature miRNA
• Sequence: 25 - UGAGUGUGUGUGUGUGAGUGUGU - 47
• Evidence: experimental ; cloned [2]

Mature hsa-miR-574-3p

• Accession: MIMAT0003239
• Description: Homo sapiens hsa-miR-574-3p mature miRNA
• Sequence: 61 - CACGCUCAUGCACACACCCACA - 82
• Evidence: experimental ; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692