WARNING: This summary was generated by AI. MIR573 is a microRNA that has been implicated in various biological processes and diseases, including cancer. It was found to be significantly negatively associated with GSDMC in breast cancer (BRCA), suggesting a potential role in the disease's molecular mechanisms [PMC9428000]. In neuroblastoma (NB), MIR573 is among the miRNAs that are positively correlated with genes enriched for miR-573 targets, indicating its involvement in NB regulation [PMC8017594]. MIR573 has been identified as a candidate microRNA with potential antagonistic functions in NB, depending on the miRISC complex status [PMC8017594]. Its precursor's expression was notably higher in certain NB tumor stages, suggesting its involvement in tumor progression [PMC8017594]. In prostate and cervical cancers, MIR573 has been associated with epithelial-mesenchymal transition (EMT), although its role is considered controversial [PMC9568336]. Additionally, MIR573 expression has been confirmed in an acute myeloid leukemia (AML) cell line and is thought to be a regulator of responsiveness to inorganic substances [PMC9568336]. Furthermore, it is regulated by transcription factor ETS1 and can negatively regulate the gene ERRFI1 to promote homeostasis during skin aging [PMC8197996]. Lastly, it was identified as one of six differentially expressed miRNAs when mesenchymal stem cells were co-cultured with human pulmonary arterial endothelial cells [PMC7675022].
-uuu -gg u -- GU -G - cu u
agc uuuc ccCUGA AGUGAU GUAACU AUCAG gau ac c
||| |||| |||||| |||||| |||||| ||||| ||| ||
uug ggag gggacu ucgcug uauuga ugguu cug ug a
guuu aga u gu -- aa u -c u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003238 |
| Description | Homo sapiens hsa-miR-573-5p mature miRNA |
| Sequence | 16 - CUGAAGUGAUGUGUAACUGAUCAG - 39 |
| Evidence |
experimental
SAGE [1] |
| Database links |
|
| Predicted targets |
|
|