miRBase entry: hsa-mir-573

Stem-loop hsa-mir-573


Accession
MI0003580
Symbol
HGNC: MIR573
Description
Homo sapiens hsa-mir-573 precursor miRNA mir-573
Gene
family?
RF01040; mir-573

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR573 is a microRNA that has been implicated in various biological processes and diseases, including cancer. It was found to be significantly negatively associated with GSDMC in breast cancer (BRCA), suggesting a potential role in the disease's molecular mechanisms [PMC9428000]. In neuroblastoma (NB), MIR573 is among the miRNAs that are positively correlated with genes enriched for miR-573 targets, indicating its involvement in NB regulation [PMC8017594]. MIR573 has been identified as a candidate microRNA with potential antagonistic functions in NB, depending on the miRISC complex status [PMC8017594]. Its precursor's expression was notably higher in certain NB tumor stages, suggesting its involvement in tumor progression [PMC8017594]. In prostate and cervical cancers, MIR573 has been associated with epithelial-mesenchymal transition (EMT), although its role is considered controversial [PMC9568336]. Additionally, MIR573 expression has been confirmed in an acute myeloid leukemia (AML) cell line and is thought to be a regulator of responsiveness to inorganic substances [PMC9568336]. Furthermore, it is regulated by transcription factor ETS1 and can negatively regulate the gene ERRFI1 to promote homeostasis during skin aging [PMC8197996]. Lastly, it was identified as one of six differentially expressed miRNAs when mesenchymal stem cells were co-cultured with human pulmonary arterial endothelial cells [PMC7675022].

Literature search
15 open access papers mention hsa-mir-573
(22 sentences)

Sequence

1177 reads, 9.0 reads per million, 54 experiments
uuuagcgguuucuccCUGAAGUGAUGUGUAACUGAUCAGgaucuacucaugucgucuuugguaaaguuaugucgcuugucagggugaggagaguuuuug
...(((..((((.((((((((((((..((((((.((((((((..((....)).))).)))))..))))))))))))..)))))).))))...)))....

Structure
-uuu   -gg    u      --      GU      -G     -   cu  u 
    agc   uuuc ccCUGA  AGUGAU  GUAACU  AUCAG gau  ac c
    |||   |||| ||||||  ||||||  ||||||  ||||| |||  ||  
    uug   ggag gggacu  ucgcug  uauuga  ugguu cug  ug a
guuu   aga    u      gu      --      aa     u   -c  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 24520192-24520290 [-]

Disease association
hsa-mir-573 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-573-5p

Accession MIMAT0003238
Description Homo sapiens hsa-miR-573-5p mature miRNA
Sequence 16 - CUGAAGUGAUGUGUAACUGAUCAG - 39
Evidence experimental
SAGE [1]
Database links
Predicted targets

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692