Stem-loop hsa-mir-92b

Accession

MI0003560

Symbol

HGNC: MIR92B

Description

Homo sapiens hsa-mir-92b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR92B, a microRNA expressed in the developing mouse brain, has been implicated in various biological processes including the attenuation of inflammatory responses and autophagy by targeting TRAF3 and the MKK3-p38 pathway in acute pancreatitis [PMC9960688]. It is predicted to reside within the Cia10 interval on rat chromosome 2 and has been shown to negatively modulate EZH2 expression, influencing autophagy in different tumor models [PMC3339715], [PMC8000899]. MIR92B is also involved in neuronal development and differentiation, with its dysregulation potentially linked to developmental processes [PMC5764268]. It has been suggested that MIR92B may target C/EBPß, a gene important for cell cycle regulation, although further research is needed to confirm this interaction in humans [PMC3732262]. In zebrafish embryos, MIR92B plays a crucial role in organogenesis and body patterning by affecting endodermal cell formation during early developmental stages [PMC9837005]. Its expression patterns vary across different tissues and developmental stages; for instance, it is differentially expressed in various organs of adult zebrafish but localized specifically within certain brain regions during embryogenesis [PMC9837005]. In human malignancies such as breast cancer, MIR92B expression inversely correlates with EZH2 levels and affects autophagy markers during basal or induced autophagy conditions [PMC6952790].

Literature search

201 open access papers mention hsa-mir-92b
(623 sentences)

Sequence

93988 reads, 954 reads per million, 128 experiments

cgggccccgggcgggcgggAGGGACGGGACGCGGUGCAGUGuuguuuuuucccccgccaaUAUUGCACUCGUCCCGGCCUCCggcccccccggccc
.(((((..(((.((((.(((((..(((((((.((((((((((((.............))))))))))))))))))).))))).))))))).)))))

Structure

c     cc   c    g     GA       C            uuuuu 
 gggcc  ggg gggc ggAGG  CGGGACG GGUGCAGUGuug     u
 |||||  ||| |||| |||||  ||||||| ||||||||||||     c
 cccgg  ccc cccg CCUCC  GCCCUGC UCACGUUAUaac     c
-     -c   -    g     -G       -            cgccc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr1: 155195177-155195272 [+]

Disease association

hsa-mir-92b is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-92b is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-92b is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-92b-5p

• Accession: MIMAT0004792
• Description: Homo sapiens hsa-miR-92b-5p mature miRNA
• Sequence: 20 - AGGGACGGGACGCGGUGCAGUG - 41
• Evidence: experimental ; cloned [2]

Mature hsa-miR-92b-3p

• Accession: MIMAT0003218
• Description: Homo sapiens hsa-miR-92b-3p mature miRNA
• Sequence: 61 - UAUUGCACUCGUCCCGGCCUCC - 82
• Evidence: experimental ; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692