Stem-loop mmu-mir-20b

Accession

MI0003536

Symbol

MGI: Mir20b

Description

Mus musculus mmu-mir-20b precursor miRNA mir-17

Gene
family

RF00051; mir-17

Literature search

87 open access papers mention mmu-mir-20b
(163 sentences)

Sequence

14341 reads, 79 reads per million, 90 experiments

ccuaguagugcCAAAGUGCUCAUAGUGCAGGUAGuuuuuauaccacucuACUGCAGUGUGAGCACUUCUAGuacuccugg
.((((.(((((..(((((((((((.(((((.(((.............)))))))).)))))))))))...))))).))))

Structure

c    u     -CA           G     G   uuuuu 
 cuag agugc   AAGUGCUCAUA UGCAG UAG     a
 |||| |||||   ||||||||||| ||||| |||     u
 gguc ucauG   UUCACGAGUGU ACGUC Auc     a
-    c     AUC           G     -   ucacc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chrX: 52742113-52742192 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from mmu-mir-20b

Mature mmu-miR-20b-5p

• Accession: MIMAT0003187
• Description: Mus musculus mmu-miR-20b-5p mature miRNA
• Sequence: 12 - CAAAGUGCUCAUAGUGCAGGUAG - 34
• Evidence: experimental ; cloned [1,3-4], MPSS [2], Illumina [5-6]

Mature mmu-miR-20b-3p

• Accession: MIMAT0004788
• Description: Mus musculus mmu-miR-20b-3p mature miRNA
• Sequence: 50 - ACUGCAGUGUGAGCACUUCUAG - 71
• Evidence: experimental ; cloned [4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


6. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267