MIR545, identified as a pre-miRNA, has been observed to play a role in cell proliferation in colorectal cancer and is significantly upregulated in endometrial cancer [PMC7199595]. Despite its upregulation, no miRNA prediction binding site tool has confirmed a direct connection between MIR545 and GPR161, suggesting that while MIR545 may promote cell proliferation in UCEC, its effects likely involve additional factors [PMC7199595]. In cervical cancer (CC), MIR545 is targeted by circ_0067934, which acts as a sponge to downregulate its expression and is implicated in the progression of CC by inhibiting MIR545 and increasing EIF3C expression [PMC9260044]. Moreover, the overexpression of MIR545 has been linked to the inhibition of Ku70 activity in radioresistant Lewis Lung Carcinoma cell lines [PMC4453103] and is regulated by HBx [PMC9280728]. However, the statement that MIR545 directly targets RIG-I regulators in pancreatic ductal adenocarcinoma is not supported by the provided reference [PMC6370596]. Experiments using miRNA mimics have shown that a mimic for MIR545 produced no phenotype compared to control cells [PMC7801944], while estrogen-related receptor γ (ESRRG) has been identified as a potential target gene inversely related to the expression of MIR545 [PMC8789654].
cccag - ----- a - U A A auaaa ccug g cac uuaguaggc c CAGUAAAUGUUU UU GAUGA u |||| | ||| ||||||||| | |||||||||||| || ||||| g ggac c gug aaucgucCG G GUUAUUUACAAA GA CUacu a ----- a cucga a U U C - cagua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004785 |
Description | Homo sapiens hsa-miR-545-5p mature miRNA |
Sequence | 25 - UCAGUAAAUGUUUAUUAGAUGA - 46 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0003165 |
Description | Homo sapiens hsa-miR-545-3p mature miRNA |
Sequence | 63 - UCAGCAAACAUUUAUUGUGUGC - 84 |
Evidence |
experimental
cloned [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|