MIR510 is a microRNA that is largely unexplored in terms of its molecular functions [PMC8441705]. It is one of the 35 candidate genes that have differential methylation sites in the promoter region [PMC8441705]. In wheat, MIR510 is one of the 58 miRNAs discovered through sequencing, and it belongs to the group of 23 novel miRNAs [PMC5360763]. A SNP (G/A) in the stem region of MIR510 has been found to enhance the production of mature miRNA [PMC7113310]. However, targets for MIR510 and other new miRNAs have been difficult to predict due to limited wheat EST sequences available in databases [PMC2394755]. In breast cancer, MIR510 has been proposed as a tumor growth promoting oncomiR that binds to PRDX I 3'UTR [PMC5362709]. High levels of MIR510 expression have been associated with a dismal relapse-free survival (RFS) rate in patients with breast cancer, particularly when related to CD30 protein expression [PMC5362709]. Additionally, MIR510 has been shown to be upregulated in Tregs from individuals with type 1 diabetes (T1D) [PMC7731293]. A deletion on Xq27.3 encompassing several genes and miRNAs including MIR510 has been observed in individuals with fragile X syndrome and other related disorders [PMC9130735]. Furthermore, point mutations have been identified in the mature coding region of MIR510 as well as other miRNAs associated with depression and other psychiatric disorders [PMC2699475][PM4883715[PM4883715].
-gug U -A A GG gua gug ucc ACUC GGAG GU CAAUCACau a ||| ||| |||| |||| || ||||||||| cac AGG UGAG UCUC CA GUUAgugug u aaug - AA - AA gau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002882 |
Description | Homo sapiens hsa-miR-510-5p mature miRNA |
Sequence | 10 - UACUCAGGAGAGUGGCAAUCAC - 31 |
Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026613 |
Description | Homo sapiens hsa-miR-510-3p mature miRNA |
Sequence | 47 - AUUGAAACCUCUAAGAGUGGA - 67 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|