MIR508 is a microRNA (miRNA) that plays a significant role in enhancing plant tolerance to salt stress and nitrogen (N) starvation in creeping bentgrass [PMC5916090]. This miRNA operates by modulating the transcription of genes such as AsAAO and AsCBP1, which are involved in maintaining water retention, cell membrane integrity, chlorophyll content, potassium homeostasis, and the activities of enzymes like CATALASE and ASCORBIC ACID OXIDASE [PMC5916090]. Additionally, MIR508 is implicated in the regulation of biomass production, N accumulation, chlorophyll synthesis, and NITRITE REDUCTASE activity under conditions of N starvation [PMC5916090]. MIR508 is part of a cluster known as the "fragile-X miRNA (FX-MIR)" cluster that includes other miRNAs such as miR506 and miR510; this cluster was identified through array-CGH analysis which revealed a deletion on Xq27.3 encompassing several genes and miRNAs [PMC9130735]. Despite its significant regulatory functions in plants, MIR508 was not detected in leaves or roots but was uniformly expressed in stems, internodes, and spikes [PMC2394755]. Furthermore, target prediction for MIR508 has been challenging due to limited sequence data available for wheat ESTs [PMC2394755].
--uuca ------ - g c GU C aaa ccacc gc uga gugua ugc cUACUCCAGAGGGC CA UCAUGu c ||||| || ||| ||||| ||| |||||||||||||| || |||||| ggugg cg acu cacau aug GAUGAGGUUUUCCG GU AGUaca u uuuaua caaugc a a A AU U aaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004778 |
Description | Homo sapiens hsa-miR-508-5p mature miRNA |
Sequence | 26 - UACUCCAGAGGGCGUCACUCAUG - 48 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002880 |
Description | Homo sapiens hsa-miR-508-3p mature miRNA |
Sequence | 61 - UGAUUGUAGCCUUUUGGAGUAGA - 83 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|