MIR505 is a microRNA that has been identified as a potential biomarker in various biological contexts and diseases [PMC9918015]. It is normalized to U6 and β-actin expression using the 2−ΔΔCT method [PMC6352865]. In the context of Parkinson's disease, MIR505 is significantly down-regulated in cerebrospinal fluid and brain tissue of patients [PMC6115491]. It has been observed to increase in the ovaries of females exposed to chlorpyrifos, suggesting a role in ovarian response to environmental toxins [PMC9918015]. MIR505 has also been proposed as a marker of ovarian aging, with its expression being induced while anti-Müllerian hormone (AMH) mRNA is reduced [PMC9918015]. In developmental biology, MIR505 can inhibit neural tube formation and cell growth through its interaction with various growth factors and signaling pathways [PMC7040864]. Its altered expression could be implicated in neural tube defects such as spina bifida, potentially through its interaction with SOX3 or independently by targeting specific genes involved in developmental pathways [PMC7040864]. Additionally, MIR505's expression can be modulated by factors such as cisplatin resistance via the Wnt/β-catenin pathway in cancer contexts [PMC9331520], and it has been identified upstream of genes like ATP11C, suggesting regulatory roles within intronic regions of other genes' transcripts [PMC4561498].
ac u G A ucug gaugc ccag ggGGGAGCCAG AAGU UUGAUGUu c ||||| |||| ||||||||||| |||| |||||||| c cuacg gguc cUCCUUUGGUC UUCA AACUGCga a -a u G C uuug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004776 |
Description | Homo sapiens hsa-miR-505-5p mature miRNA |
Sequence | 15 - GGGAGCCAGGAAGUAUUGAUGU - 36 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002876 |
Description | Homo sapiens hsa-miR-505-3p mature miRNA |
Sequence | 51 - CGUCAACACUUGCUGGUUUCCU - 72 |
Evidence |
experimental
array-cloned [1], cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|