MIR503 is a microRNA that has been studied in the context of various diseases, including esophageal squamous cell carcinoma (ESCC) [PMC6694630]. In a study analyzing the gene expression profile of pHPL-ASC passage-specific genes, it was found that MIR503 was consistently downregulated in all passages (P1 to P5) [PMC6694630]. Furthermore, when comparing tumor samples from ESCC patients to adjacent non-tumorous tissues, a significant decrease in MIR503 expression was observed in 83% of the patients [PMC5487524]. This suggests that MIR503 may play a role in the development or progression of ESCC [PMC5487524]. Additionally, it has been noted that MIR503 is present in the 3' fragment of mir322 and may influence its fate [PMC4057207]. These findings highlight the potential importance of MIR503 as a biomarker or therapeutic target for ESCC [PMC6694630][PMC5487524][PMC4057207[PMC5487524][PMC4057207]. Further research is needed to elucidate its precise role and mechanisms of action in this context [PMC6694630][PMC5487524][PMC4057207[PMC5487524][PMC4057207].
A U G Gu a ugcccU GCAGCGGGAACAGU CU CA gagcg u |||||| |||||||||||||| || || ||||| c augGGA CGUCGCCUUUGUUA GG Gu cucgu g C U G -- g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002874 |
Description | Homo sapiens hsa-miR-503-5p mature miRNA |
Sequence | 6 - UAGCAGCGGGAACAGUUCUGCAG - 28 |
Evidence |
experimental
array-cloned [1], cloned [2-3], SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0022925 |
Description | Homo sapiens hsa-miR-503-3p mature miRNA |
Sequence | 46 - GGGGUAUUGUUUCCGCUGCCAGG - 68 |
Evidence |
experimental
SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|