miRBase entry: hsa-mir-501

Stem-loop hsa-mir-501


Accession
MI0003185
Symbol
HGNC: MIR501
Description
Homo sapiens hsa-mir-501 precursor miRNA mir-500
Gene
family?
RF01903; mir-500

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR501 is a microRNA that has been found to be elevated in plasma in cases of community-acquired pneumonia (CAP), along with other miRNAs such as MIR100, MIR99A, MIR483, MIR141, MIR378C, and MIR193B [PMC8358855]. In wheat, sequencing efforts have identified 58 wheat miRNAs, including 23 novel ones such as MIR501 [PMC5360763]. In a study on schizophrenia, two single-nucleotide polymorphisms upstream of MIR501 and two ultrarare protein-altering variants in its host gene CLCN5 were found to be associated with the disorder [PMC9390987]. The function of miR-501-3p in schizophrenia was investigated using a mouse model with the knockout of the MIR501 gene [PMC9390987]. The human counterpart of mouse MIR501 is located on chromosome Xp11.23 within the CLCN5 gene [PMC9390987]. MiR-501-3p has been shown to be highly expressed in multiple tissues and specific neuronal types [PMC9390987]. The role of miR-501-3p in the pathophysiology of schizophrenia is still being investigated [PMC9390987]. MiR-501 is part of a cluster that includes other microRNAs such as miR532 and miR362 [PMC4241533]. MiR500A is also part of this cluster and has been associated with different cancer types [PMC8253104]. In addition to its role in schizophrenia, miR-501 has also been implicated in synaptic plasticity regulation and periodontitis pathogenesis [PMC4783348] [PMC9314012].

Literature search
35 open access papers mention hsa-mir-501
(59 sentences)

Sequence

9875 reads, 179 reads per million, 128 experiments
gcucuuccucucuAAUCCUUUGUCCCUGGGUGAGAgugcuuucugaaugcAAUGCACCCGGGCAAGGAUUCUgagagggugagc
((((.(((((((.(((((((.(.(((.(((((....(((.........)))...))))))))))))))))..))))))).))))

Structure
    u       -u       U U   U     AGAg   uuu 
gcuc uccucuc  AAUCCUU G CCC GGGUG    ugc   c
|||| |||||||  ||||||| | ||| |||||    |||   u
cgag gggagag  UUAGGAA C GGG CCCAC    Acg   g
    u       UC       - -   -     -GUA   uaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 50009722-50009805 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from hsa-mir-501
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-501 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-501-5p

Accession MIMAT0002872
Description Homo sapiens hsa-miR-501-5p mature miRNA
Sequence 14 - AAUCCUUUGUCCCUGGGUGAGA - 35
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-501-3p

Accession MIMAT0004774
Description Homo sapiens hsa-miR-501-3p mature miRNA
Sequence 51 - AAUGCACCCGGGCAAGGAUUCU - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770