In our study, we failed to observe an association of the polymorphism in the rs3746444 polymorphism of MIR499A and the miR-499a expression [1]. MIR499A expression was also examined in Ad-HBV or Ad-GFP infected HepG2 cells [2]. In addition, we explored the target gene of MIR499A to disclose the underlying mechanism of MIR499A functions in HCC [2]. References: 1. Zhang, Y., Zhang, Y., Li, X., Zhang, X., Liang, H., Liang, W., ... & Wang, Y. (2021). The association between polymorphisms in microRNA genes and hepatocellular carcinoma risk: a meta-analysis. BMC cancer, 21(1), 1-12. [PMC8514969] 2. Wang, Y., Tohme, S., & Gao, Z. (2014). MicroRNA: a new therapeutic target for human hepatocellular carcinoma. Gastroenterology research and practice 2014. [PMC4207808]
ccugu cuu - c u UA A acucc gcccugucc gc ggg cggg ggc gU AGACUUGC GUGAUGUUUa u ||||||||| || ||| |||| ||| || |||||||| |||||||||| c ugggacggg cg ccc gccc ucg CG UCUGAACG CACUACAAgu u uccgu cau u u U UG A gcacc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002870 |
Description | Homo sapiens hsa-miR-499a-5p mature miRNA |
Sequence | 33 - UUAAGACUUGCAGUGAUGUUU - 53 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004772 |
Description | Homo sapiens hsa-miR-499a-3p mature miRNA |
Sequence | 70 - AACAUCACAGCAAGUCUGUGCU - 91 |
Evidence |
experimental
cloned [2] |
|