MIR499A is a microRNA implicated in various cellular processes, and its expression and potential associations with diseases have been a subject of research [PMC4207808]. In a recent study, no significant correlation was found between the rs3746444 polymorphism of MIR499A and the expression levels of miR-499a [PMC8514969]. This suggests that this particular polymorphism may not play a role in regulating MIR499A expression or its functional consequences. Furthermore, the study investigated MIR499A expression in HepG2 cells, a human liver cancer cell line, following infection with either adenovirus expressing hepatitis B virus (Ad-HBV) or adenovirus expressing green fluorescent protein (Ad-GFP) [PMC4207808]. This was likely done to understand the impact of viral infection on MIR499A expression. Additionally, to elucidate the functional role of MIR499A in hepatocellular carcinoma (HCC), researchers identified and explored its target gene [PMC4207808]. The identification of target genes is crucial for understanding the molecular mechanisms through which microRNAs like MIR499A exert their effects on cellular functions and disease progression.
ccugu cuu - c u UA A acucc gcccugucc gc ggg cggg ggc gU AGACUUGC GUGAUGUUUa u ||||||||| || ||| |||| ||| || |||||||| |||||||||| c ugggacggg cg ccc gccc ucg CG UCUGAACG CACUACAAgu u uccgu cau u u U UG A gcacc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002870 |
Description | Homo sapiens hsa-miR-499a-5p mature miRNA |
Sequence | 33 - UUAAGACUUGCAGUGAUGUUU - 53 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004772 |
Description | Homo sapiens hsa-miR-499a-3p mature miRNA |
Sequence | 70 - AACAUCACAGCAAGUCUGUGCU - 91 |
Evidence |
experimental
cloned [2] |
|