miRBase entry: hsa-mir-518e

Stem-loop hsa-mir-518e


Accession
MI0003169
Symbol
HGNC: MIR518E
Description
Homo sapiens hsa-mir-518e precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-518e is a miRNA that has been found to be upregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal controls [PMC5649611]. It is one of the 12 miRNAs that are upregulated in PDAC tissues, along with hsa-miR-10b, hsa-miR-575, hsa-miR-159a, hsa-miR-644, hsa-miR-581, hsa-miR-637, hsa-miR-935, hsa-miR-98, hsa-miR-513-3p, hsa-mir-518e (hsa) [PMC5649611]. Additionally, it has been found to be significantly dysregulated in 9 comparisons [PMC4268797]. In a study comparing neural stem cells (NSC) and induced pluripotent stem cells (iPSC), the expression of hsa-mir-518e was highly decreased in NSC cells compared to iPSC [PMC6696086]. This suggests that it may be a negative regulator of neural differentiation from iPSC [PMC6696086]. Furthermore, it has been identified as one of the miRNAs characteristic for the transition from iPSC to NSC along with other miRNAs such as mir-302 family and let7 family [PMC6696086]. In hepatocellular carcinoma (HCC), both hsa-mir518e and its homologue hsa-mir518b have been found to be upregulated [PMC5937522].

Literature search
9 open access papers mention hsa-mir-518e
(11 sentences)

Sequence

101 reads, 16 reads per million, 21 experiments
ucucaggcugugaccCUCUAGAGGGAAGCGCUUUCUGuuggcuaaaagaaaagAAAGCGCUUCCCUUCAGAGUGuuaacgcuuugaga
((((((((..((((.((((.((((((((((((((((...............)))))))))))))))).)))).))))..)).))))))

Structure
      -  ug    c    A                Guuggc 
ucucag gc  ugac CUCU GAGGGAAGCGCUUUCU      u
|||||| ||  |||| |||| ||||||||||||||||      a
agaguu cg  auuG GAGA UUCCCUUCGCGAAAga      a
      u  ca    U    C                aaagaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 53729838-53729925 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-518e
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-518e is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-518e-5p

Accession MIMAT0005450
Description Homo sapiens hsa-miR-518e-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-518e-3p

Accession MIMAT0002861
Description Homo sapiens hsa-miR-518e-3p mature miRNA
Sequence 54 - AAAGCGCUUCCCUUCAGAGUG - 74
Evidence experimental
array-cloned [1], cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770