Hsa-mir-517b is a microRNA isoform transcribed from the C19MC cluster and is implicated in various cellular processes, including cancer progression and differentiation [PMC8666996]. It has been associated with lower cancer stages and has a positive impact on patient survival, suggesting its potential role as a prognostic biomarker [PMC7648123]. The expression levels of hsa-mir-517b are linked with clinical stages I–III of cancer, indicating its involvement in the early stages of tumor development [PMC7499949]. Additionally, hsa-mir-517b is differentially expressed during sodium butyrate (NaB)-induced differentiation, highlighting its role in embryonic stem (ES) cell processes [PMC2581805]. Genetic variations such as the transition from allele G to allele A at rs1063053 can affect the binding site of hsa-mir-517b, which may have functional consequences on gene regulation [PMC5810033]. The expression of hsa-mir-517b has been quantitatively analyzed using specific microRNA assays to further understand its role in cellular functions [PMC3937405]. Moreover, this microRNA is involved in reducing pluripotency and contributing to chondrogenic processes, indicating its significance in stem cell differentiation and development [PMC6770352].
C U A U guugu gugac CUCUAGA GGA GCAC GUCU c ||||| ||||||| ||| |||| |||| u cauUG GAGAUUU CCU CGUG UAga a U C A C aaaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002851 |
Description | Homo sapiens hsa-miR-517-5p mature miRNA |
Sequence | 6 - CCUCUAGAUGGAAGCACUGUCU - 27 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0002857 |
Description | Homo sapiens hsa-miR-517b-3p mature miRNA |
Sequence | 43 - AUCGUGCAUCCCUUUAGAGUGU - 64 |
Evidence |
experimental
array-cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|