MIR517A is a placenta-specific miRNA that is only detected in certain types of mesenchymal stem cells (MSCs) [PMC5388876]. It has been shown that certain maternally derived miRNAs, including MIR517A, originate from the placenta, circulate in the mother's plasma, and are cleared shortly after delivery [PMC7468461]. In an individual from Tibet, MIR517A is found to be under copy number variations (CNVs) [PMC3938728]. Studies with BeWo cells have demonstrated that the syncytiotrophoblast (STB) is the main source of released MIR517A [PMC7465902]. In hepatocellular carcinoma (HCC), there are no significant differences in the expression of MIR517A between patients with and without preeclampsia (PE) [PMC4540200]. Furthermore, MIR517A expression has been detected in breast invasive carcinoma samples [PMC6193703]. It has been shown that MIR517A belongs to the C19MC cluster on chromosome 19 and has been associated with stem cell biology and tumorigenesis [PMC8508841]. In patients tested for RNA expression levels, both mir519d and MIR517A showed little to no expression, indicating correct pathological subtyping [PMC9623263]. References: - PMC5388876 - PMC7468461 - PMC3938728 - PMC7465902 - PMC4540200 - PMC6193703 - PMC8508841 - PMC9623263
C U A U guugua ucucaggcagugac CUCUAGA GGA GCAC GUCU u |||||||||||||| ||||||| ||| |||| |||| a agaguuugucauUG GAGAUUU CCU CGUG UAga a U C A C aaagaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002851 |
Description | Homo sapiens hsa-miR-517-5p mature miRNA |
Sequence | 15 - CCUCUAGAUGGAAGCACUGUCU - 36 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0002852 |
Description | Homo sapiens hsa-miR-517a-3p mature miRNA |
Sequence | 54 - AUCGUGCAUCCCUUUAGAGUGU - 75 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|