MIR524 is a microRNA that is involved in various biological processes [PMC6193703]. It is part of the C19MC miRNA gene cluster, which consists of 46 miRNA genes [PMC6193703]. In breast invasive carcinoma, the expression of MIR524 is downregulated by an overexpressed EGFR/myc axis, leading to the activation of the TGF-β, Notch, and Hippo pathways [PMC9966483]. MIR524 also plays a role in regulating gene expression through its interaction with other molecules [PMC3938728]. It has been found to downregulate targets such as OLR1, CPEB4, and DUSP1 [PMC3938728]. Additionally, MIR524 is regulated by EGFR through recruitment of a repressive histone modifier to its promoter region [PMC7766154].
u c A A Cuug a ucuca gcugugac CU CAAAGGGAAGC CUUUCU ucc ||||| |||||||| || ||||||||||| |||||| ||| a agagu uggcauug GA GUUUCCCUUCG GGAAGa agg u U G C --aa a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002849 |
Description | Homo sapiens hsa-miR-524-5p mature miRNA |
Sequence | 16 - CUACAAAGGGAAGCACUUUCUC - 37 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002850 |
Description | Homo sapiens hsa-miR-524-3p mature miRNA |
Sequence | 53 - GAAGGCGCUUCCCUUUGGAGU - 73 |
Evidence |
experimental
array-cloned [1] |
|