MIR523 is a miRNA gene that is part of the C19MC miRNA gene cluster on chromosome 19 [PMC6193703]. In breast invasive carcinoma, the expression of MIR523 was not significantly different between the CAA and control groups when using a variable threshold, but became significantly different when using a fixed threshold [PMC7157974]. Additionally, MIR523 was close to being significantly different in other analyses [PMC7157974]. However, the targets for MIR523 and other miRNAs in the C19MC cluster could not be predicted due to limited available sequences in databases [PMC2394755]. In hepatocellular carcinoma (HCC), the expression of MIR523 and other C19MC miRNA genes was analyzed using TCGA miRNA-seq dataset and matched to HCC-iCluster RNA-seq data set to create an integrated dataset [PMC7378193]. Furthermore, MIR523 is part of a subset of miRNAs on chromosome 19 that have been associated with stem cell biology and tumorigenesis [PMC8508841]. References: - [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/ - [PMC7157974]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7157974/ - [PMC2394755]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2394755/ - [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/ - [PM8508841]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM8508841/
ugcu G U Guug g ucuca gugaccCUCUA AGGGAAGCGC UUCU ucu ||||| ||||||||||| |||||||||| |||| ||| a agagu cauUGGGAGAU UCCCUUCGCG AAGa aga uucc A C --aa a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005449 |
Description | Homo sapiens hsa-miR-523-5p mature miRNA |
Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002840 |
Description | Homo sapiens hsa-miR-523-3p mature miRNA |
Sequence | 53 - GAACGCGCUUCCCUAUAGAGGGU - 75 |
Evidence |
experimental
array-cloned [1], cloned [2] |
|