MIR519C is a placenta-specific microRNA gene belonging to the C19MC cluster, which is known to play a role in the regulation of gene expression, particularly in the placenta where it is produced by trophoblasts [PMC6460512]. This microRNA can be released in different forms, including as free miRNA or within extracellular vesicles (EVs) [PMC6460512]. In individuals from Australia, MIR519C and its target gene PDCD1LG2 were found to be disrupted by copy number variations (CNVs), indicating a potential impact on gene regulation [PMC3938728]. MIR519C has been implicated in the inhibition of TNFα gene expression within placental explant models, suggesting its involvement in inflammatory response modulation [PMC6460512]. Additionally, MIR519C has been associated with effects on transcription stability and protein translation [PMC10138346]. The expression of MIR519C has been analyzed in various datasets including those from liver hepatocellular carcinoma (LIHC) and breast invasive carcinoma, indicating its relevance in cancer research and potential role in tumorigenesis as part of the C19MC miRNA cluster [PMC7378193; PMC6193703; PMC8508841]..
c c A Guug g
ucucag cuguga cCUCUAGAGGGA GCGCUUUCU ucu
|||||| |||||| |||||||||||| ||||||||| ||| a
agaguu gacauU GGAGAUUUUUCU CGUGAAAga aga
u A A --aa a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002831 |
| Description | Homo sapiens hsa-miR-519c-5p mature miRNA |
| Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002832 |
| Description | Homo sapiens hsa-miR-519c-3p mature miRNA |
| Sequence | 54 - AAAGUGCAUCUUUUUAGAGGAU - 75 |
| Evidence |
experimental
array-cloned [1] |
|