MIR519C is a placenta-specific miRNA that is produced by trophoblasts and can be released as free miRNA or packaged into extracellular vesicles (EVs) [PMC6460512]. It has been shown to inhibit TNFα gene expression in placental explant models [PMC6460512]. MIR519C is part of the C19MC cluster on chromosome 19, which includes a total of 46 miRNA genes [PMC7378193]. It has been found to be disrupted in individuals from both the New World and Australia, along with other miRNAs such as MIR519B, MIR526B, and MIR519D [PMC3938728]. In breast invasive carcinoma, the expression of MIR519C and other miRNAs from the C19MC cluster has been analyzed and associated with stem cell biology and tumorigenesis [PMC8508841]. Additionally, several microRNAs including MIR519C have been shown to affect transcription stability and protein translation [PMC10138346]. The expression of all 46 C19MC miRNA genes, including MIR519C, has been analyzed in liver hepatocellular carcinoma (HCC) using TCGA datasets [PMC7378193]. Similarly, the cumulative expression of C19MC miRNA genes has also been analyzed in breast invasive carcinoma using RNA-seq datasets [PMC6193703]. References: - [PMC3938728]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3938728/ - [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/ - [PMC6460512]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6460512/ - [PM10138346]: https://pubmed.ncbi.nlm.nih.gov/10138346/ - [PMC8508841]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8508841/ - [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/
c c A Guug g ucucag cuguga cCUCUAGAGGGA GCGCUUUCU ucu |||||| |||||| |||||||||||| ||||||||| ||| a agaguu gacauU GGAGAUUUUUCU CGUGAAAga aga u A A --aa a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002831 |
Description | Homo sapiens hsa-miR-519c-5p mature miRNA |
Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002832 |
Description | Homo sapiens hsa-miR-519c-3p mature miRNA |
Sequence | 54 - AAAGUGCAUCUUUUUAGAGGAU - 75 |
Evidence |
experimental
array-cloned [1] |
|