MIR520F is a miRNA gene that has been studied in various contexts. In glioblastoma patients, the levels of MIR520F, along with other miRNAs such as miR-21, miR-218, and miR-193b, were found to correlate with those detected from tissue biopsies [PMC6679205]. In hepatocellular carcinoma (HCC), the TCGA miRNA-seq dataset was used to analyze the cumulative expression of all 46 C19MC miRNA genes, including MIR520F [PMC7378193]. Furthermore, in glioblastoma patients, a panel of nine miRNAs including MIR520F was found to correlate with tissue biopsies and showed associations with tumor volume [PMC7014190] [PMC9965735]. Additionally, MIR520F was listed as part of a group of microRNAs detected in cerebrospinal fluid (CSF) samples [PMC8833415]. In breast invasive carcinoma samples, cumulative expression analysis included MIR520F among the 46 C19MC miRNA genes studied [PMC6193703]. Finally, in the context of recurrent pregnancy loss (RPL), MIR520F was found to be downregulated along with other microRNAs such as miR3175 and miR4672 [PMC5572592]. These studies highlight the involvement and potential significance of MIR520F in various diseases and biological processes.
u --------- u ucucaggc gugacCCUCUAAAGGGAAGCGCUU UCUg g |||||||| |||||||||||||||||||||||| |||| aggguuug caUUGGGAGAUUUUCCUUCGUGAA agac g c cgaaaagaa u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002830 |
Description | Homo sapiens hsa-miR-520f-3p mature miRNA |
Sequence | 55 - AAGUGCUUCCUUUUAGAGGGUU - 76 |
Evidence |
experimental
array-cloned [1], Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026609 |
Description | Homo sapiens hsa-miR-520f-5p mature miRNA |
Sequence | 15 - CCUCUAAAGGGAAGCGCUUUCU - 36 |
Evidence |
experimental
Illumina [2] |
|