MIR520F is a microRNA gene that is part of the C19MC miRNA cluster, which includes a group of 46 miRNA genes [PMC7378193]. It has been identified in various studies involving different types of cancer and has been detected in the cerebrospinal fluid (CSF) of glioblastoma patients [PMC7014190]. The expression levels of MIR520F, along with other miRNAs, have been found to correlate with glioblastoma tissue biopsy samples and are associated with tumor volume, showing a 67% sensitivity and 80% specificity in distinguishing tumor presence [PMC9965735]. MIR520F is also part of a larger group of microRNAs detected in CSF samples that are being studied for their potential roles in cancer diagnostics [PMC8833415]. In breast invasive carcinoma research, cumulative expression data for the C19MC miRNA cluster, which includes MIR520F, has been processed to understand its role in cancer gene expression [PMC6193703]. However, MIR520F has also been identified as being downregulated in the villus tissue from women with recurrent pregnancy loss (RPL), suggesting its potential involvement beyond oncology and into reproductive health processes [PMC5572592].
u --------- u ucucaggc gugacCCUCUAAAGGGAAGCGCUU UCUg g |||||||| |||||||||||||||||||||||| |||| aggguuug caUUGGGAGAUUUUCCUUCGUGAA agac g c cgaaaagaa u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002830 |
Description | Homo sapiens hsa-miR-520f-3p mature miRNA |
Sequence | 55 - AAGUGCUUCCUUUUAGAGGGUU - 76 |
Evidence |
experimental
array-cloned [1], Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026609 |
Description | Homo sapiens hsa-miR-520f-5p mature miRNA |
Sequence | 15 - CCUCUAAAGGGAAGCGCUUUCU - 36 |
Evidence |
experimental
Illumina [2] |
|