WARNING: This summary was generated by AI. MIR498 is a microRNA gene from the C19MC miRNA cluster, which has been implicated in various cellular processes, including apoptosis and autophagy in cancer cells [PMC5302951]. It has been observed that the overexpression of MIR498 can lead to an increase in early apoptotic fractions in esophageal cancer cells, suggesting its role in promoting apoptosis [PMC5302951]. Additionally, MIR498 is involved in the autophagy pathway, as indicated by its effects on LC3 and p62 protein levels upon transfection into esophageal cancer cell lines [PMC5302951]. Moreover, MIR498 has been linked to the regulation of cell death processes as it can modulate both autophagy and apoptosis [PMC5302951]. In ovarian cancer models, 1,25(OH)2D3 was found to suppress leptin and high-fat diet-induced ovarian cancer through a pathway involving MIR498 [PMC6114234], while its inhibition led to increased proliferation and decreased apoptosis which was reversed by silencing EP300 [PMC8430307]. In breast invasive carcinoma gene expression studies involving C19MC miRNA genes including MIR498 were conducted to understand their cumulative expression patterns [PMC6193703], while synthetic miR-498 mimics were used to demonstrate that transfection could increase intracellular levels of miR-498 [PMC9276052].
aaccc aagugaag - - A C uaua
uccuuggg cucaggcuguga UUUCAAGC C GGGGG GUUUUUC a
|||||||| |||||||||||| |||||||| | ||||| ||||||| c
aggaaucu gaguuugacacu GAAGUUCG G CCUCC CGAAAag u
-uuga gcuaacga C A A A uagg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002824 |
| Description | Homo sapiens hsa-miR-498-5p mature miRNA |
| Sequence | 34 - UUUCAAGCCAGGGGGCGUUUUUC - 56 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0037323 |
| Description | Homo sapiens hsa-miR-498-3p mature miRNA |
| Sequence | 70 - AAAGCACCUCCAGAGCUUGAAGC - 92 |
| Evidence |
experimental
Illumina [3] |
|