MIR498 is a miRNA gene that has been implicated in various biological processes and diseases [PMC6114234]. It has been reported that 1,25(OH)2D3, a form of vitamin D, can suppress leptin and high-fat diet-induced ovarian cancer through the MIR498 pathway [PMC6114234]. The TCGA miRNA-seq dataset of liver hepatocellular carcinoma (HCC) was used to analyze the expression of all 46 C19MC miRNA genes, including MIR498 [PMC7378193]. MIR498 has been found to have a pol III peak in CD4+ T cells but not HeLa cells [PMC2917008]. Inhibition of MIR498 has been shown to increase proliferation and decrease apoptosis, which can be reversed by silencing the EP300 gene [PMC8430307]. In esophageal cancer cells, transfection of MIR498 along with other miRNAs (MIR20b, MIR30e, and MIR196) affected both the apoptotic pathway and autophagy [PMC5302951]. Similarly, in breast invasive carcinoma cells, cumulative expression analysis revealed the presence of MIR498 along with other C19MC miRNA genes [PMC6193703]. Synthetic mimics of MIR498 have also been used to increase intracellular levels of this miRNA [PMC9276052].
aaccc aagugaag - - A C uaua uccuuggg cucaggcuguga UUUCAAGC C GGGGG GUUUUUC a |||||||| |||||||||||| |||||||| | ||||| ||||||| c aggaaucu gaguuugacacu GAAGUUCG G CCUCC CGAAAag u -uuga gcuaacga C A A A uagg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002824 |
Description | Homo sapiens hsa-miR-498-5p mature miRNA |
Sequence | 34 - UUUCAAGCCAGGGGGCGUUUUUC - 56 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0037323 |
Description | Homo sapiens hsa-miR-498-3p mature miRNA |
Sequence | 70 - AAAGCACCUCCAGAGCUUGAAGC - 92 |
Evidence |
experimental
Illumina [3] |
|