MIR512-1 is a miRNA gene that belongs to the C19MC miRNA gene cluster. It is a placental-specific miRNA gene that has been found to have complex methylation patterns. The promoter of the pri-miRNA for MIR512-1 is maternally methylated in placenta but fully methylated in somatic tissues [PMC3975056]. The methylation profiling of the MIR512-1 cluster has revealed that the differentially methylated region (DMR) of MIR512-1 is unmethylated in hydatidiform moles compared to partially methylated placenta [PMC3975056]. The DMR of MIR512-1 is approximately 5 kb in size and includes the promoter CpG island [PMC3975056]. Interestingly, most placental-specific DMRs, including MIR512-1, do not inherit methylation from gametes and are devoid of methylation in human embryonic stem cells [PMC3975056'>PMC3975056]. These complex methylation states at the MIR512-1 locus dictate complex allelic expression, with restricted paternal expression of the MIR512-1 pri-miRNA and reciprocal imprinting of ZNF331 [PMC3975056]. Additionally, it has been found that there may be more unknown imprinted DMRs solely present in placental tissues, as highlighted by the presence of DMRs for both MIR512-1 and GPR1-AS [PMC3975056]. The cumulative expression levels of all 46 C19MC miRNA genes, including MIR512-1, have been analyzed in breast invasive carcinoma using miRNASeq dataset [PMC6193703].
u ug CA CU G uggug cucaguc ugg CUCAGC UGA GGCACUUUC c ||||||| ||| |||||| ||| ||||||||| gagucag acC GAGUCG ACU UCGUGAAag c g ua UG AU G uaaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002822 |
Description | Homo sapiens hsa-miR-512-5p mature miRNA |
Sequence | 14 - CACUCAGCCUUGAGGGCACUUUC - 36 |
Evidence |
experimental
array-cloned [1] |
Accession | MIMAT0002823 |
Description | Homo sapiens hsa-miR-512-3p mature miRNA |
Sequence | 51 - AAGUGCUGUCAUAGCUGAGGUC - 72 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|