MIR497 is a microRNA implicated in the regulation of neuronal death post-ischemia, as demonstrated in previous research [PMC4998122]. The current study marks the first instance of establishing a link between MIR497 and the neuronal damage that occurs as a result of seizures [PMC4998122]. Additionally, MIR497 has been associated with the modulation of lung cancer cells' resistance to cisplatin, a chemotherapy drug, through a mechanism that involves AKT2 [PMC8787930]. Furthermore, it has been reported that LINC00152 can act as a molecular sponge for MIR497, thereby serving as its negative regulator and influencing its activity within cells [PMC7011539].
cca c ---- g - ----- G C U -- ac cc cggu ccu cucccgccc C AGCA CACA UGUGGUUUG ac ggc u || |||| ||| ||||||||| | |||| |||| ||||||||| || ||| gg gccg gga ggggguggg g UUGU GUGU ACACCAAAC ug ccg g --- a ccac - a cgAGA G C c ca gu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002820 |
Description | Homo sapiens hsa-miR-497-5p mature miRNA |
Sequence | 24 - CAGCAGCACACUGUGGUUUGU - 44 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004768 |
Description | Homo sapiens hsa-miR-497-3p mature miRNA |
Sequence | 64 - CAAACCACACUGUGGUGUUAGA - 85 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|