MIR193B is identified as a tumor suppressor in the hematopoietic system, with a significant role in the regulation of cell cycle and apoptosis in Acute Myelocytic Leukemia (AML) [PMC7273449]. It has been shown to induce apoptosis and cause G1/S-phase cell cycle arrest across various AML subtypes, suggesting its potential as a therapeutic target [PMC7273449]. The genetic locus of MIR193B is within the MIR193B host gene (MIR193BHG) on chromosome 16 of the human genome, as per the GRCh38/hg38 assembly available on the UCSC Genome Browser [PMC9779864]. This locus is also characterized by its high sequence conservation across different species, indicating its evolutionary importance and potential functional significance [PMC9779864].
                                        u               G  A  A  uua 
guggucucagaa CGGGGUUUUGAGGGC AG UG gu   u
|||||||||||| ||||||||||||||| || || ||   g
uacugggguuuU GCCCUGAAACUCCCG UC Ac ua   u
            C               G  A  c  uuu 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0004767 | 
| Description | Homo sapiens hsa-miR-193b-5p mature miRNA | 
| Sequence | 14 - CGGGGUUUUGAGGGCGAGAUGA - 35 | 
| Evidence | 
                                    experimental
                                    
                                     cloned [3-4]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0002819 | 
| Description | Homo sapiens hsa-miR-193b-3p mature miRNA | 
| Sequence | 51 - AACUGGCCCUCAAAGUCCCGCU - 72 | 
| Evidence | 
                                    experimental
                                    
                                     array-cloned [1], cloned [2-4]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
                        
  |