miRBase entry: hsa-mir-193b

Stem-loop hsa-mir-193b


Accession
MI0003137
Symbol
HGNC: MIR193B
Description
Homo sapiens hsa-mir-193b precursor miRNA mir-193
Gene
family?
RF01895; mir-193

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR193B is identified as a tumor suppressor in the hematopoietic system, with a significant role in the regulation of cell cycle and apoptosis in Acute Myelocytic Leukemia (AML) [PMC7273449]. It has been shown to induce apoptosis and cause G1/S-phase cell cycle arrest across various AML subtypes, suggesting its potential as a therapeutic target [PMC7273449]. The genetic locus of MIR193B is within the MIR193B host gene (MIR193BHG) on chromosome 16 of the human genome, as per the GRCh38/hg38 assembly available on the UCSC Genome Browser [PMC9779864]. This locus is also characterized by its high sequence conservation across different species, indicating its evolutionary importance and potential functional significance [PMC9779864].

Literature search
160 open access papers mention hsa-mir-193b
(415 sentences)

Sequence

114184 reads, 1060 reads per million, 134 experiments
guggucucagaauCGGGGUUUUGAGGGCGAGAUGAguuuauguuuuauccAACUGGCCCUCAAAGUCCCGCUuuuggggucau
((((((((((((.(((((((((((((((.((.((.((.........)).)).)).))))))))))))))).))))))))))))

Structure
            u               G  A  A  uua 
guggucucagaa CGGGGUUUUGAGGGC AG UG gu   u
|||||||||||| ||||||||||||||| || || ||   g
uacugggguuuU GCCCUGAAACUCCCG UC Ac ua   u
            C               G  A  c  uuu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr16: 14303967-14304049 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-193b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-193b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-193b-5p

Accession MIMAT0004767
Description Homo sapiens hsa-miR-193b-5p mature miRNA
Sequence 14 - CGGGGUUUUGAGGGCGAGAUGA - 35
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-193b-3p

Accession MIMAT0002819
Description Homo sapiens hsa-miR-193b-3p mature miRNA
Sequence 51 - AACUGGCCCUCAAAGUCCCGCU - 72
Evidence experimental
array-cloned [1], cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267