MIR495 is a microRNA implicated in various biological processes, including tumorigenesis and metastasis, and has been identified as a potential player in uveal melanoma (UM) [PMC2902045]. In a study, the combination of MIR495 and doxorubicin (DOX) encapsulated in cell-penetrating carrier molecules (CCM) with surface ligand integration (SLI) and redox-responsive disassembly (R-D) demonstrated significantly enhanced therapeutic efficacy against cancer, with tumor volume reduction [PMC6841775]. MIR495 has also been observed to be overexpressed in the RTT-mouse model, where it is known to repress the expression of Bdnf [PMC8595945]. In lung cancer research focusing on multidrug resistance (MDR), MIR495's role was investigated concerning the regulation of P-glycoprotein (P-gp), a critical factor in drug resistance mechanisms [PMC6841775]. The study utilized MIR495 supplied by Cell Biolabs Inc. to examine its interaction with SLI through gel retardation assays, comparing it against uncoated MIR495 as a control [PMC6841775]. The methodology for coating CCM onto SLI/R-D was analogous to that used for binding MIR495, ensuring consistency in experimental procedures [PMC6841775].
u U - AU - uuu ugguacc gaaaaGAAGU GC CCAUGUU UUUCG c a ||||||| |||||||||| || ||||||| ||||| | u acuaugg uuuUUCUUCA CG GGUACAA AAAgc g a c - U AC a ugu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002817 |
Description | Homo sapiens hsa-miR-495-3p mature miRNA |
Sequence | 50 - AAACAAACAUGGUGCACUUCUU - 71 |
Evidence |
experimental
array-cloned [1], cloned [2], SOLiD [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0022924 |
Description | Homo sapiens hsa-miR-495-5p mature miRNA |
Sequence | 14 - GAAGUUGCCCAUGUUAUUUUCG - 35 |
Evidence |
experimental
SOLiD [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|