miRBase entry: hsa-mir-494

Stem-loop hsa-mir-494


Accession
MI0003134
Symbol
HGNC: MIR494
Description
Homo sapiens hsa-mir-494 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR494 is a microRNA that has been found to play a role in various biological processes, particularly in cancer [PMC4722626]. It has been observed that MIR494 expression leads to a reduction in cholesterol levels, which is associated with increased cell death and an apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the regulation of cellular viability. Additionally, MIR494 has been identified as an oncogenic miRNA that is upregulated in various cancers, along with miR155-5p, miR493, and miR519a [PMC9775527]. These findings highlight the potential significance of MIR494 in cancer development and progression. Furthermore, MIR494 has been found to regulate the expression of ATF3 and JUN [PMC4774345]. ATF3 is a transcription factor involved in cellular stress response and JUN is a proto-oncogene involved in cell proliferation and differentiation. The regulation of these genes by MIR494 suggests its involvement in modulating key signaling pathways associated with cancer development [PMC4774345]. Overall, these studies provide insights into the role of MIR494 as an oncogenic microRNA involved in cholesterol regulation and the modulation of key genes implicated in cancer progression.

Literature search
149 open access papers mention hsa-mir-494
(1211 sentences)

Sequence

3110 reads, 45 reads per million, 99 experiments
gauacucgaaggagAGGUUGUCCGUGUUGUCUUCUCUuuauuuaugaUGAAACAUACACGGGAAACCUCuuuuuuaguauc
((((((.((((((((((((.((((((((((.(((((.........)).)))))).))))))).))))))))))))))))))

Structure
      c            G       -   C   -  Uuu 
gauacu gaaggagAGGUU UCCGUGU UGU UUC UC   a
|||||| |||||||||||| ||||||| ||| ||| ||   u
cuauga uuuuuuCUCCAA GGGCACA ACA AAG ag   u
      -            A       U   -   U  uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr14: 101029634-101029714 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from hsa-mir-494
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-494 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-494-3p

Accession MIMAT0002816
Description Homo sapiens hsa-miR-494-3p mature miRNA
Sequence 48 - UGAAACAUACACGGGAAACCUC - 69
Evidence experimental
array-cloned [1], cloned [2-3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-494-5p

Accession MIMAT0026607
Description Homo sapiens hsa-miR-494-5p mature miRNA
Sequence 15 - AGGUUGUCCGUGUUGUCUUCUCU - 37
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45