MIR494 is a microRNA that has been found to play a role in various biological processes, particularly in cancer [PMC4722626]. It has been observed that MIR494 expression leads to a reduction in cholesterol levels, which is associated with increased cell death and an apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the regulation of cellular viability. Additionally, MIR494 has been identified as an oncogenic miRNA that is upregulated in various cancers, along with miR155-5p, miR493, and miR519a [PMC9775527]. These findings highlight the potential significance of MIR494 in cancer development and progression. Furthermore, MIR494 has been found to regulate the expression of ATF3 and JUN [PMC4774345]. ATF3 is a transcription factor involved in cellular stress response and JUN is a proto-oncogene involved in cell proliferation and differentiation. The regulation of these genes by MIR494 suggests its involvement in modulating key signaling pathways associated with cancer development [PMC4774345]. Overall, these studies provide insights into the role of MIR494 as an oncogenic microRNA involved in cholesterol regulation and the modulation of key genes implicated in cancer progression.
c G - C - Uuu gauacu gaaggagAGGUU UCCGUGU UGU UUC UC a |||||| |||||||||||| ||||||| ||| ||| || u cuauga uuuuuuCUCCAA GGGCACA ACA AAG ag u - A U - U uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002816 |
Description | Homo sapiens hsa-miR-494-3p mature miRNA |
Sequence | 48 - UGAAACAUACACGGGAAACCUC - 69 |
Evidence |
experimental
array-cloned [1], cloned [2-3], Illumina [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026607 |
Description | Homo sapiens hsa-miR-494-5p mature miRNA |
Sequence | 15 - AGGUUGUCCGUGUUGUCUUCUCU - 37 |
Evidence |
experimental
Illumina [4] |
|